ID: 1035076519

View in Genome Browser
Species Human (GRCh38)
Location 7:156181143-156181165
Sequence CTGCAGCCAGCTCCTTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035076513_1035076519 18 Left 1035076513 7:156181102-156181124 CCGCGGCCAGCTCCTTGCTCTGC No data
Right 1035076519 7:156181143-156181165 CTGCAGCCAGCTCCTTGCTCTGG No data
1035076516_1035076519 -6 Left 1035076516 7:156181126-156181148 CCAAGACATCCTCAAGCCTGCAG No data
Right 1035076519 7:156181143-156181165 CTGCAGCCAGCTCCTTGCTCTGG No data
1035076512_1035076519 19 Left 1035076512 7:156181101-156181123 CCCGCGGCCAGCTCCTTGCTCTG No data
Right 1035076519 7:156181143-156181165 CTGCAGCCAGCTCCTTGCTCTGG No data
1035076509_1035076519 27 Left 1035076509 7:156181093-156181115 CCCTCCAGCCCGCGGCCAGCTCC No data
Right 1035076519 7:156181143-156181165 CTGCAGCCAGCTCCTTGCTCTGG No data
1035076515_1035076519 6 Left 1035076515 7:156181114-156181136 CCTTGCTCTGCACCAAGACATCC No data
Right 1035076519 7:156181143-156181165 CTGCAGCCAGCTCCTTGCTCTGG No data
1035076511_1035076519 23 Left 1035076511 7:156181097-156181119 CCAGCCCGCGGCCAGCTCCTTGC No data
Right 1035076519 7:156181143-156181165 CTGCAGCCAGCTCCTTGCTCTGG No data
1035076514_1035076519 12 Left 1035076514 7:156181108-156181130 CCAGCTCCTTGCTCTGCACCAAG No data
Right 1035076519 7:156181143-156181165 CTGCAGCCAGCTCCTTGCTCTGG No data
1035076510_1035076519 26 Left 1035076510 7:156181094-156181116 CCTCCAGCCCGCGGCCAGCTCCT No data
Right 1035076519 7:156181143-156181165 CTGCAGCCAGCTCCTTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035076519 Original CRISPR CTGCAGCCAGCTCCTTGCTC TGG Intergenic
No off target data available for this crispr