ID: 1035076549

View in Genome Browser
Species Human (GRCh38)
Location 7:156181428-156181450
Sequence GGTGGCTGCATGGCATAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035076549_1035076555 7 Left 1035076549 7:156181428-156181450 CCACTTTATGCCATGCAGCCACC No data
Right 1035076555 7:156181458-156181480 ACACAGATAAGACCTGGTTTGGG No data
1035076549_1035076556 8 Left 1035076549 7:156181428-156181450 CCACTTTATGCCATGCAGCCACC No data
Right 1035076556 7:156181459-156181481 CACAGATAAGACCTGGTTTGGGG No data
1035076549_1035076557 9 Left 1035076549 7:156181428-156181450 CCACTTTATGCCATGCAGCCACC No data
Right 1035076557 7:156181460-156181482 ACAGATAAGACCTGGTTTGGGGG No data
1035076549_1035076553 1 Left 1035076549 7:156181428-156181450 CCACTTTATGCCATGCAGCCACC No data
Right 1035076553 7:156181452-156181474 TCAATAACACAGATAAGACCTGG No data
1035076549_1035076554 6 Left 1035076549 7:156181428-156181450 CCACTTTATGCCATGCAGCCACC No data
Right 1035076554 7:156181457-156181479 AACACAGATAAGACCTGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035076549 Original CRISPR GGTGGCTGCATGGCATAAAG TGG (reversed) Intergenic
No off target data available for this crispr