ID: 1035076608

View in Genome Browser
Species Human (GRCh38)
Location 7:156181862-156181884
Sequence CTGGGAAAGGGGAAGAGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035076608_1035076612 -8 Left 1035076608 7:156181862-156181884 CCAGTGCTCTTCCCCTTTCCCAG No data
Right 1035076612 7:156181877-156181899 TTTCCCAGTGTTTACACATCTGG No data
1035076608_1035076615 2 Left 1035076608 7:156181862-156181884 CCAGTGCTCTTCCCCTTTCCCAG No data
Right 1035076615 7:156181887-156181909 TTTACACATCTGGTTGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035076608 Original CRISPR CTGGGAAAGGGGAAGAGCAC TGG (reversed) Intergenic
No off target data available for this crispr