ID: 1035079214

View in Genome Browser
Species Human (GRCh38)
Location 7:156202348-156202370
Sequence TGAGATGATGGAGAACCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035079214_1035079221 6 Left 1035079214 7:156202348-156202370 CCCCAAGGTTCTCCATCATCTCA No data
Right 1035079221 7:156202377-156202399 CCAAAACAAAATCCACTGGCTGG No data
1035079214_1035079219 2 Left 1035079214 7:156202348-156202370 CCCCAAGGTTCTCCATCATCTCA No data
Right 1035079219 7:156202373-156202395 GGCTCCAAAACAAAATCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035079214 Original CRISPR TGAGATGATGGAGAACCTTG GGG (reversed) Intergenic
No off target data available for this crispr