ID: 1035079217

View in Genome Browser
Species Human (GRCh38)
Location 7:156202352-156202374
Sequence AAGGTTCTCCATCATCTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035079211_1035079217 1 Left 1035079211 7:156202328-156202350 CCGCTCCAGGAGAGAGATGGCCC No data
Right 1035079217 7:156202352-156202374 AAGGTTCTCCATCATCTCATTGG No data
1035079212_1035079217 -4 Left 1035079212 7:156202333-156202355 CCAGGAGAGAGATGGCCCCAAGG No data
Right 1035079217 7:156202352-156202374 AAGGTTCTCCATCATCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035079217 Original CRISPR AAGGTTCTCCATCATCTCAT TGG Intergenic
No off target data available for this crispr