ID: 1035079219

View in Genome Browser
Species Human (GRCh38)
Location 7:156202373-156202395
Sequence GGCTCCAAAACAAAATCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035079215_1035079219 1 Left 1035079215 7:156202349-156202371 CCCAAGGTTCTCCATCATCTCAT No data
Right 1035079219 7:156202373-156202395 GGCTCCAAAACAAAATCCACTGG No data
1035079216_1035079219 0 Left 1035079216 7:156202350-156202372 CCAAGGTTCTCCATCATCTCATT No data
Right 1035079219 7:156202373-156202395 GGCTCCAAAACAAAATCCACTGG No data
1035079214_1035079219 2 Left 1035079214 7:156202348-156202370 CCCCAAGGTTCTCCATCATCTCA No data
Right 1035079219 7:156202373-156202395 GGCTCCAAAACAAAATCCACTGG No data
1035079211_1035079219 22 Left 1035079211 7:156202328-156202350 CCGCTCCAGGAGAGAGATGGCCC No data
Right 1035079219 7:156202373-156202395 GGCTCCAAAACAAAATCCACTGG No data
1035079218_1035079219 -10 Left 1035079218 7:156202360-156202382 CCATCATCTCATTGGCTCCAAAA No data
Right 1035079219 7:156202373-156202395 GGCTCCAAAACAAAATCCACTGG No data
1035079212_1035079219 17 Left 1035079212 7:156202333-156202355 CCAGGAGAGAGATGGCCCCAAGG No data
Right 1035079219 7:156202373-156202395 GGCTCCAAAACAAAATCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035079219 Original CRISPR GGCTCCAAAACAAAATCCAC TGG Intergenic
No off target data available for this crispr