ID: 1035080560

View in Genome Browser
Species Human (GRCh38)
Location 7:156212542-156212564
Sequence CTCTCCTAACAGCTAGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035080558_1035080560 3 Left 1035080558 7:156212516-156212538 CCTGCTCTCTTCTTTTTATGAAC No data
Right 1035080560 7:156212542-156212564 CTCTCCTAACAGCTAGAATGTGG No data
1035080556_1035080560 24 Left 1035080556 7:156212495-156212517 CCCAGGAAGTTTGCTTCTGAACC No data
Right 1035080560 7:156212542-156212564 CTCTCCTAACAGCTAGAATGTGG No data
1035080557_1035080560 23 Left 1035080557 7:156212496-156212518 CCAGGAAGTTTGCTTCTGAACCT No data
Right 1035080560 7:156212542-156212564 CTCTCCTAACAGCTAGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035080560 Original CRISPR CTCTCCTAACAGCTAGAATG TGG Intergenic
No off target data available for this crispr