ID: 1035082049

View in Genome Browser
Species Human (GRCh38)
Location 7:156224448-156224470
Sequence ACAGCCTTGGCACAGGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035082049_1035082056 22 Left 1035082049 7:156224448-156224470 CCCCAGCCCTGTGCCAAGGCTGT No data
Right 1035082056 7:156224493-156224515 AATCTGTTCTGATGGTGACGAGG No data
1035082049_1035082055 14 Left 1035082049 7:156224448-156224470 CCCCAGCCCTGTGCCAAGGCTGT No data
Right 1035082055 7:156224485-156224507 ACACTGAGAATCTGTTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035082049 Original CRISPR ACAGCCTTGGCACAGGGCTG GGG (reversed) Intergenic