ID: 1035082051

View in Genome Browser
Species Human (GRCh38)
Location 7:156224450-156224472
Sequence CTACAGCCTTGGCACAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035082051_1035082055 12 Left 1035082051 7:156224450-156224472 CCAGCCCTGTGCCAAGGCTGTAG No data
Right 1035082055 7:156224485-156224507 ACACTGAGAATCTGTTCTGATGG No data
1035082051_1035082056 20 Left 1035082051 7:156224450-156224472 CCAGCCCTGTGCCAAGGCTGTAG No data
Right 1035082056 7:156224493-156224515 AATCTGTTCTGATGGTGACGAGG No data
1035082051_1035082057 30 Left 1035082051 7:156224450-156224472 CCAGCCCTGTGCCAAGGCTGTAG No data
Right 1035082057 7:156224503-156224525 GATGGTGACGAGGCATTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035082051 Original CRISPR CTACAGCCTTGGCACAGGGC TGG (reversed) Intergenic
No off target data available for this crispr