ID: 1035082052

View in Genome Browser
Species Human (GRCh38)
Location 7:156224454-156224476
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035082052_1035082057 26 Left 1035082052 7:156224454-156224476 CCCTGTGCCAAGGCTGTAGCGTT No data
Right 1035082057 7:156224503-156224525 GATGGTGACGAGGCATTCCTAGG No data
1035082052_1035082056 16 Left 1035082052 7:156224454-156224476 CCCTGTGCCAAGGCTGTAGCGTT No data
Right 1035082056 7:156224493-156224515 AATCTGTTCTGATGGTGACGAGG No data
1035082052_1035082055 8 Left 1035082052 7:156224454-156224476 CCCTGTGCCAAGGCTGTAGCGTT No data
Right 1035082055 7:156224485-156224507 ACACTGAGAATCTGTTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035082052 Original CRISPR AACGCTACAGCCTTGGCACA GGG (reversed) Intergenic