ID: 1035082053

View in Genome Browser
Species Human (GRCh38)
Location 7:156224455-156224477
Sequence AAACGCTACAGCCTTGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035082053_1035082055 7 Left 1035082053 7:156224455-156224477 CCTGTGCCAAGGCTGTAGCGTTT No data
Right 1035082055 7:156224485-156224507 ACACTGAGAATCTGTTCTGATGG No data
1035082053_1035082056 15 Left 1035082053 7:156224455-156224477 CCTGTGCCAAGGCTGTAGCGTTT No data
Right 1035082056 7:156224493-156224515 AATCTGTTCTGATGGTGACGAGG No data
1035082053_1035082057 25 Left 1035082053 7:156224455-156224477 CCTGTGCCAAGGCTGTAGCGTTT No data
Right 1035082057 7:156224503-156224525 GATGGTGACGAGGCATTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035082053 Original CRISPR AAACGCTACAGCCTTGGCAC AGG (reversed) Intergenic