ID: 1035082056

View in Genome Browser
Species Human (GRCh38)
Location 7:156224493-156224515
Sequence AATCTGTTCTGATGGTGACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035082053_1035082056 15 Left 1035082053 7:156224455-156224477 CCTGTGCCAAGGCTGTAGCGTTT No data
Right 1035082056 7:156224493-156224515 AATCTGTTCTGATGGTGACGAGG No data
1035082050_1035082056 21 Left 1035082050 7:156224449-156224471 CCCAGCCCTGTGCCAAGGCTGTA No data
Right 1035082056 7:156224493-156224515 AATCTGTTCTGATGGTGACGAGG No data
1035082052_1035082056 16 Left 1035082052 7:156224454-156224476 CCCTGTGCCAAGGCTGTAGCGTT No data
Right 1035082056 7:156224493-156224515 AATCTGTTCTGATGGTGACGAGG No data
1035082054_1035082056 9 Left 1035082054 7:156224461-156224483 CCAAGGCTGTAGCGTTTGTCTCA No data
Right 1035082056 7:156224493-156224515 AATCTGTTCTGATGGTGACGAGG No data
1035082049_1035082056 22 Left 1035082049 7:156224448-156224470 CCCCAGCCCTGTGCCAAGGCTGT No data
Right 1035082056 7:156224493-156224515 AATCTGTTCTGATGGTGACGAGG No data
1035082051_1035082056 20 Left 1035082051 7:156224450-156224472 CCAGCCCTGTGCCAAGGCTGTAG No data
Right 1035082056 7:156224493-156224515 AATCTGTTCTGATGGTGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035082056 Original CRISPR AATCTGTTCTGATGGTGACG AGG Intergenic
No off target data available for this crispr