ID: 1035082306

View in Genome Browser
Species Human (GRCh38)
Location 7:156226943-156226965
Sequence GGCAAGTGCCAGAGGGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035082298_1035082306 8 Left 1035082298 7:156226912-156226934 CCAGCAGAAGAATGAGGGTAGGA No data
Right 1035082306 7:156226943-156226965 GGCAAGTGCCAGAGGGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035082306 Original CRISPR GGCAAGTGCCAGAGGGGTCA GGG Intergenic
No off target data available for this crispr