ID: 1035083071

View in Genome Browser
Species Human (GRCh38)
Location 7:156233528-156233550
Sequence CAGCCCCAAGACCTTGCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035083069_1035083071 -1 Left 1035083069 7:156233506-156233528 CCATTCTGGGGAGGGGGAGGGGC No data
Right 1035083071 7:156233528-156233550 CAGCCCCAAGACCTTGCAGGCGG No data
1035083057_1035083071 14 Left 1035083057 7:156233491-156233513 CCGGGCCTCGTGATGCCATTCTG No data
Right 1035083071 7:156233528-156233550 CAGCCCCAAGACCTTGCAGGCGG No data
1035083061_1035083071 9 Left 1035083061 7:156233496-156233518 CCTCGTGATGCCATTCTGGGGAG No data
Right 1035083071 7:156233528-156233550 CAGCCCCAAGACCTTGCAGGCGG No data
1035083056_1035083071 15 Left 1035083056 7:156233490-156233512 CCCGGGCCTCGTGATGCCATTCT No data
Right 1035083071 7:156233528-156233550 CAGCCCCAAGACCTTGCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035083071 Original CRISPR CAGCCCCAAGACCTTGCAGG CGG Intergenic
No off target data available for this crispr