ID: 1035083498

View in Genome Browser
Species Human (GRCh38)
Location 7:156236747-156236769
Sequence CAGATGTTGGAGAGAGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035083492_1035083498 3 Left 1035083492 7:156236721-156236743 CCGGAGCCTCAGAGCCAGATTCT No data
Right 1035083498 7:156236747-156236769 CAGATGTTGGAGAGAGCAGGTGG No data
1035083491_1035083498 13 Left 1035083491 7:156236711-156236733 CCTGGAGCTGCCGGAGCCTCAGA No data
Right 1035083498 7:156236747-156236769 CAGATGTTGGAGAGAGCAGGTGG No data
1035083494_1035083498 -3 Left 1035083494 7:156236727-156236749 CCTCAGAGCCAGATTCTCGGCAG No data
Right 1035083498 7:156236747-156236769 CAGATGTTGGAGAGAGCAGGTGG No data
1035083490_1035083498 14 Left 1035083490 7:156236710-156236732 CCCTGGAGCTGCCGGAGCCTCAG No data
Right 1035083498 7:156236747-156236769 CAGATGTTGGAGAGAGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035083498 Original CRISPR CAGATGTTGGAGAGAGCAGG TGG Intergenic
No off target data available for this crispr