ID: 1035085327

View in Genome Browser
Species Human (GRCh38)
Location 7:156253201-156253223
Sequence TGAGAATCACGGGTCCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035085327_1035085333 -7 Left 1035085327 7:156253201-156253223 CCACCTTGGACCCGTGATTCTCA No data
Right 1035085333 7:156253217-156253239 ATTCTCAACGGCAGGCAGTTTGG No data
1035085327_1035085334 3 Left 1035085327 7:156253201-156253223 CCACCTTGGACCCGTGATTCTCA No data
Right 1035085334 7:156253227-156253249 GCAGGCAGTTTGGCAGTGTCTGG No data
1035085327_1035085335 18 Left 1035085327 7:156253201-156253223 CCACCTTGGACCCGTGATTCTCA No data
Right 1035085335 7:156253242-156253264 GTGTCTGGAGACCCCATGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035085327 Original CRISPR TGAGAATCACGGGTCCAAGG TGG (reversed) Intergenic
No off target data available for this crispr