ID: 1035085328

View in Genome Browser
Species Human (GRCh38)
Location 7:156253204-156253226
Sequence CGTTGAGAATCACGGGTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035085328_1035085334 0 Left 1035085328 7:156253204-156253226 CCTTGGACCCGTGATTCTCAACG No data
Right 1035085334 7:156253227-156253249 GCAGGCAGTTTGGCAGTGTCTGG No data
1035085328_1035085333 -10 Left 1035085328 7:156253204-156253226 CCTTGGACCCGTGATTCTCAACG No data
Right 1035085333 7:156253217-156253239 ATTCTCAACGGCAGGCAGTTTGG No data
1035085328_1035085335 15 Left 1035085328 7:156253204-156253226 CCTTGGACCCGTGATTCTCAACG No data
Right 1035085335 7:156253242-156253264 GTGTCTGGAGACCCCATGTTTGG No data
1035085328_1035085339 29 Left 1035085328 7:156253204-156253226 CCTTGGACCCGTGATTCTCAACG No data
Right 1035085339 7:156253256-156253278 CATGTTTGGTTGCCATAACGTGG No data
1035085328_1035085340 30 Left 1035085328 7:156253204-156253226 CCTTGGACCCGTGATTCTCAACG No data
Right 1035085340 7:156253257-156253279 ATGTTTGGTTGCCATAACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035085328 Original CRISPR CGTTGAGAATCACGGGTCCA AGG (reversed) Intergenic
No off target data available for this crispr