ID: 1035085332

View in Genome Browser
Species Human (GRCh38)
Location 7:156253212-156253234
Sequence CTGCCTGCCGTTGAGAATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035085332_1035085335 7 Left 1035085332 7:156253212-156253234 CCGTGATTCTCAACGGCAGGCAG No data
Right 1035085335 7:156253242-156253264 GTGTCTGGAGACCCCATGTTTGG No data
1035085332_1035085341 23 Left 1035085332 7:156253212-156253234 CCGTGATTCTCAACGGCAGGCAG No data
Right 1035085341 7:156253258-156253280 TGTTTGGTTGCCATAACGTGGGG No data
1035085332_1035085344 28 Left 1035085332 7:156253212-156253234 CCGTGATTCTCAACGGCAGGCAG No data
Right 1035085344 7:156253263-156253285 GGTTGCCATAACGTGGGGAGGGG No data
1035085332_1035085343 27 Left 1035085332 7:156253212-156253234 CCGTGATTCTCAACGGCAGGCAG No data
Right 1035085343 7:156253262-156253284 TGGTTGCCATAACGTGGGGAGGG No data
1035085332_1035085339 21 Left 1035085332 7:156253212-156253234 CCGTGATTCTCAACGGCAGGCAG No data
Right 1035085339 7:156253256-156253278 CATGTTTGGTTGCCATAACGTGG No data
1035085332_1035085334 -8 Left 1035085332 7:156253212-156253234 CCGTGATTCTCAACGGCAGGCAG No data
Right 1035085334 7:156253227-156253249 GCAGGCAGTTTGGCAGTGTCTGG No data
1035085332_1035085342 26 Left 1035085332 7:156253212-156253234 CCGTGATTCTCAACGGCAGGCAG No data
Right 1035085342 7:156253261-156253283 TTGGTTGCCATAACGTGGGGAGG No data
1035085332_1035085340 22 Left 1035085332 7:156253212-156253234 CCGTGATTCTCAACGGCAGGCAG No data
Right 1035085340 7:156253257-156253279 ATGTTTGGTTGCCATAACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035085332 Original CRISPR CTGCCTGCCGTTGAGAATCA CGG (reversed) Intergenic
No off target data available for this crispr