ID: 1035085334

View in Genome Browser
Species Human (GRCh38)
Location 7:156253227-156253249
Sequence GCAGGCAGTTTGGCAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035085331_1035085334 -7 Left 1035085331 7:156253211-156253233 CCCGTGATTCTCAACGGCAGGCA No data
Right 1035085334 7:156253227-156253249 GCAGGCAGTTTGGCAGTGTCTGG No data
1035085327_1035085334 3 Left 1035085327 7:156253201-156253223 CCACCTTGGACCCGTGATTCTCA No data
Right 1035085334 7:156253227-156253249 GCAGGCAGTTTGGCAGTGTCTGG No data
1035085332_1035085334 -8 Left 1035085332 7:156253212-156253234 CCGTGATTCTCAACGGCAGGCAG No data
Right 1035085334 7:156253227-156253249 GCAGGCAGTTTGGCAGTGTCTGG No data
1035085328_1035085334 0 Left 1035085328 7:156253204-156253226 CCTTGGACCCGTGATTCTCAACG No data
Right 1035085334 7:156253227-156253249 GCAGGCAGTTTGGCAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035085334 Original CRISPR GCAGGCAGTTTGGCAGTGTC TGG Intergenic
No off target data available for this crispr