ID: 1035092632

View in Genome Browser
Species Human (GRCh38)
Location 7:156327073-156327095
Sequence CAGTATCTGATGGTATCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035092632_1035092634 2 Left 1035092632 7:156327073-156327095 CCAACAGATACCATCAGATACTG No data
Right 1035092634 7:156327098-156327120 AGACAACAACAGATACTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035092632 Original CRISPR CAGTATCTGATGGTATCTGT TGG (reversed) Intergenic
No off target data available for this crispr