ID: 1035095662

View in Genome Browser
Species Human (GRCh38)
Location 7:156352735-156352757
Sequence CTGTACTAGATGAGGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035095662_1035095672 25 Left 1035095662 7:156352735-156352757 CCATCCTGCCTCATCTAGTACAG No data
Right 1035095672 7:156352783-156352805 CTCTAAACCAGGGTGGTCCAGGG No data
1035095662_1035095667 15 Left 1035095662 7:156352735-156352757 CCATCCTGCCTCATCTAGTACAG No data
Right 1035095667 7:156352773-156352795 GACCCAGTCTCTCTAAACCAGGG No data
1035095662_1035095666 14 Left 1035095662 7:156352735-156352757 CCATCCTGCCTCATCTAGTACAG No data
Right 1035095666 7:156352772-156352794 AGACCCAGTCTCTCTAAACCAGG No data
1035095662_1035095670 18 Left 1035095662 7:156352735-156352757 CCATCCTGCCTCATCTAGTACAG No data
Right 1035095670 7:156352776-156352798 CCAGTCTCTCTAAACCAGGGTGG No data
1035095662_1035095671 24 Left 1035095662 7:156352735-156352757 CCATCCTGCCTCATCTAGTACAG No data
Right 1035095671 7:156352782-156352804 TCTCTAAACCAGGGTGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035095662 Original CRISPR CTGTACTAGATGAGGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr