ID: 1035096431

View in Genome Browser
Species Human (GRCh38)
Location 7:156359966-156359988
Sequence TCATGTGCTCCTCAGAATTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035096431_1035096435 -7 Left 1035096431 7:156359966-156359988 CCGGAATTCTGAGGAGCACATGA No data
Right 1035096435 7:156359982-156360004 CACATGAGTGCAGGGGCACTTGG No data
1035096431_1035096436 4 Left 1035096431 7:156359966-156359988 CCGGAATTCTGAGGAGCACATGA No data
Right 1035096436 7:156359993-156360015 AGGGGCACTTGGTGTGTCCTTGG No data
1035096431_1035096442 19 Left 1035096431 7:156359966-156359988 CCGGAATTCTGAGGAGCACATGA No data
Right 1035096442 7:156360008-156360030 GTCCTTGGCGTGGGGTCCTGGGG No data
1035096431_1035096444 23 Left 1035096431 7:156359966-156359988 CCGGAATTCTGAGGAGCACATGA No data
Right 1035096444 7:156360012-156360034 TTGGCGTGGGGTCCTGGGGAAGG No data
1035096431_1035096440 17 Left 1035096431 7:156359966-156359988 CCGGAATTCTGAGGAGCACATGA No data
Right 1035096440 7:156360006-156360028 GTGTCCTTGGCGTGGGGTCCTGG No data
1035096431_1035096446 27 Left 1035096431 7:156359966-156359988 CCGGAATTCTGAGGAGCACATGA No data
Right 1035096446 7:156360016-156360038 CGTGGGGTCCTGGGGAAGGCGGG No data
1035096431_1035096445 26 Left 1035096431 7:156359966-156359988 CCGGAATTCTGAGGAGCACATGA No data
Right 1035096445 7:156360015-156360037 GCGTGGGGTCCTGGGGAAGGCGG No data
1035096431_1035096439 11 Left 1035096431 7:156359966-156359988 CCGGAATTCTGAGGAGCACATGA No data
Right 1035096439 7:156360000-156360022 CTTGGTGTGTCCTTGGCGTGGGG No data
1035096431_1035096437 9 Left 1035096431 7:156359966-156359988 CCGGAATTCTGAGGAGCACATGA No data
Right 1035096437 7:156359998-156360020 CACTTGGTGTGTCCTTGGCGTGG No data
1035096431_1035096441 18 Left 1035096431 7:156359966-156359988 CCGGAATTCTGAGGAGCACATGA No data
Right 1035096441 7:156360007-156360029 TGTCCTTGGCGTGGGGTCCTGGG No data
1035096431_1035096438 10 Left 1035096431 7:156359966-156359988 CCGGAATTCTGAGGAGCACATGA No data
Right 1035096438 7:156359999-156360021 ACTTGGTGTGTCCTTGGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035096431 Original CRISPR TCATGTGCTCCTCAGAATTC CGG (reversed) Intergenic
No off target data available for this crispr