ID: 1035096442

View in Genome Browser
Species Human (GRCh38)
Location 7:156360008-156360030
Sequence GTCCTTGGCGTGGGGTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035096431_1035096442 19 Left 1035096431 7:156359966-156359988 CCGGAATTCTGAGGAGCACATGA No data
Right 1035096442 7:156360008-156360030 GTCCTTGGCGTGGGGTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035096442 Original CRISPR GTCCTTGGCGTGGGGTCCTG GGG Intergenic
No off target data available for this crispr