ID: 1035096473

View in Genome Browser
Species Human (GRCh38)
Location 7:156360121-156360143
Sequence CCTCTGTGTCCCCAGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035096473_1035096483 18 Left 1035096473 7:156360121-156360143 CCCTGCACCTGGGGACACAGAGG No data
Right 1035096483 7:156360162-156360184 TCTCATTTACCTCACCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035096473 Original CRISPR CCTCTGTGTCCCCAGGTGCA GGG (reversed) Intergenic
No off target data available for this crispr