ID: 1035096483

View in Genome Browser
Species Human (GRCh38)
Location 7:156360162-156360184
Sequence TCTCATTTACCTCACCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035096478_1035096483 -6 Left 1035096478 7:156360145-156360167 CCGTTCCACCGTCCTCCTCTCAT No data
Right 1035096483 7:156360162-156360184 TCTCATTTACCTCACCTCCTTGG No data
1035096468_1035096483 29 Left 1035096468 7:156360110-156360132 CCCTTATCTCACCCTGCACCTGG No data
Right 1035096483 7:156360162-156360184 TCTCATTTACCTCACCTCCTTGG No data
1035096467_1035096483 30 Left 1035096467 7:156360109-156360131 CCCCTTATCTCACCCTGCACCTG No data
Right 1035096483 7:156360162-156360184 TCTCATTTACCTCACCTCCTTGG No data
1035096476_1035096483 11 Left 1035096476 7:156360128-156360150 CCTGGGGACACAGAGGCCCGTTC No data
Right 1035096483 7:156360162-156360184 TCTCATTTACCTCACCTCCTTGG No data
1035096475_1035096483 17 Left 1035096475 7:156360122-156360144 CCTGCACCTGGGGACACAGAGGC No data
Right 1035096483 7:156360162-156360184 TCTCATTTACCTCACCTCCTTGG No data
1035096473_1035096483 18 Left 1035096473 7:156360121-156360143 CCCTGCACCTGGGGACACAGAGG No data
Right 1035096483 7:156360162-156360184 TCTCATTTACCTCACCTCCTTGG No data
1035096470_1035096483 28 Left 1035096470 7:156360111-156360133 CCTTATCTCACCCTGCACCTGGG No data
Right 1035096483 7:156360162-156360184 TCTCATTTACCTCACCTCCTTGG No data
1035096477_1035096483 -5 Left 1035096477 7:156360144-156360166 CCCGTTCCACCGTCCTCCTCTCA No data
Right 1035096483 7:156360162-156360184 TCTCATTTACCTCACCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035096483 Original CRISPR TCTCATTTACCTCACCTCCT TGG Intergenic
No off target data available for this crispr