ID: 1035105131

View in Genome Browser
Species Human (GRCh38)
Location 7:156435663-156435685
Sequence GGCCGCTGGGAGCAAAGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035105131_1035105145 24 Left 1035105131 7:156435663-156435685 CCGCGCCTTTGCTCCCAGCGGCC No data
Right 1035105145 7:156435710-156435732 GCCGCCCATTCTCCCCACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035105131 Original CRISPR GGCCGCTGGGAGCAAAGGCG CGG (reversed) Intergenic
No off target data available for this crispr