ID: 1035107270

View in Genome Browser
Species Human (GRCh38)
Location 7:156452316-156452338
Sequence CAAGGTGCTTATATTGTATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035107270_1035107275 1 Left 1035107270 7:156452316-156452338 CCCAATACAATATAAGCACCTTG No data
Right 1035107275 7:156452340-156452362 GAACACAGACCTCCTCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035107270 Original CRISPR CAAGGTGCTTATATTGTATT GGG (reversed) Intergenic
No off target data available for this crispr