ID: 1035107300

View in Genome Browser
Species Human (GRCh38)
Location 7:156452555-156452577
Sequence ACTTACATTCAGGTGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035107293_1035107300 5 Left 1035107293 7:156452527-156452549 CCAAAATGCCTTACAAAGGCTCA No data
Right 1035107300 7:156452555-156452577 ACTTACATTCAGGTGGGGCAGGG No data
1035107292_1035107300 6 Left 1035107292 7:156452526-156452548 CCCAAAATGCCTTACAAAGGCTC No data
Right 1035107300 7:156452555-156452577 ACTTACATTCAGGTGGGGCAGGG No data
1035107294_1035107300 -3 Left 1035107294 7:156452535-156452557 CCTTACAAAGGCTCAGTGATACT No data
Right 1035107300 7:156452555-156452577 ACTTACATTCAGGTGGGGCAGGG No data
1035107291_1035107300 7 Left 1035107291 7:156452525-156452547 CCCCAAAATGCCTTACAAAGGCT No data
Right 1035107300 7:156452555-156452577 ACTTACATTCAGGTGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035107300 Original CRISPR ACTTACATTCAGGTGGGGCA GGG Intergenic
No off target data available for this crispr