ID: 1035108847

View in Genome Browser
Species Human (GRCh38)
Location 7:156463811-156463833
Sequence CTCGGGATTCAGGTGTCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035108841_1035108847 0 Left 1035108841 7:156463788-156463810 CCTACAAAAGGAATTTCTTGGCC No data
Right 1035108847 7:156463811-156463833 CTCGGGATTCAGGTGTCACCTGG No data
1035108838_1035108847 26 Left 1035108838 7:156463762-156463784 CCTGAGAATAAAAGGTTTCTGTG No data
Right 1035108847 7:156463811-156463833 CTCGGGATTCAGGTGTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035108847 Original CRISPR CTCGGGATTCAGGTGTCACC TGG Intergenic
No off target data available for this crispr