ID: 1035111363

View in Genome Browser
Species Human (GRCh38)
Location 7:156484918-156484940
Sequence ATGGAGGCCTAGAGAGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035111363_1035111369 12 Left 1035111363 7:156484918-156484940 CCTTGATCTCTCTAGGCCTCCAT No data
Right 1035111369 7:156484953-156484975 CAAGTGGAGAGGCTGACAGATGG No data
1035111363_1035111367 1 Left 1035111363 7:156484918-156484940 CCTTGATCTCTCTAGGCCTCCAT No data
Right 1035111367 7:156484942-156484964 TCCTCAGTCGTCAAGTGGAGAGG No data
1035111363_1035111366 -4 Left 1035111363 7:156484918-156484940 CCTTGATCTCTCTAGGCCTCCAT No data
Right 1035111366 7:156484937-156484959 CCATATCCTCAGTCGTCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035111363 Original CRISPR ATGGAGGCCTAGAGAGATCA AGG (reversed) Intergenic
No off target data available for this crispr