ID: 1035112505

View in Genome Browser
Species Human (GRCh38)
Location 7:156494999-156495021
Sequence TACAGGATGGTGTACATGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035112505_1035112511 14 Left 1035112505 7:156494999-156495021 CCTAGCATGTACACCATCCTGTA No data
Right 1035112511 7:156495036-156495058 ACCTTGTATTTCCTAGAGCAGGG No data
1035112505_1035112513 15 Left 1035112505 7:156494999-156495021 CCTAGCATGTACACCATCCTGTA No data
Right 1035112513 7:156495037-156495059 CCTTGTATTTCCTAGAGCAGGGG No data
1035112505_1035112510 13 Left 1035112505 7:156494999-156495021 CCTAGCATGTACACCATCCTGTA No data
Right 1035112510 7:156495035-156495057 CACCTTGTATTTCCTAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035112505 Original CRISPR TACAGGATGGTGTACATGCT AGG (reversed) Intergenic
No off target data available for this crispr