ID: 1035112506

View in Genome Browser
Species Human (GRCh38)
Location 7:156495009-156495031
Sequence ACACCATCCTGTATCAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035112503_1035112506 -5 Left 1035112503 7:156494991-156495013 CCTCCACACCTAGCATGTACACC No data
Right 1035112506 7:156495009-156495031 ACACCATCCTGTATCAGAGATGG No data
1035112504_1035112506 -8 Left 1035112504 7:156494994-156495016 CCACACCTAGCATGTACACCATC No data
Right 1035112506 7:156495009-156495031 ACACCATCCTGTATCAGAGATGG No data
1035112502_1035112506 29 Left 1035112502 7:156494957-156494979 CCTGTGTTTCATGATGTGAAACA No data
Right 1035112506 7:156495009-156495031 ACACCATCCTGTATCAGAGATGG No data
1035112501_1035112506 30 Left 1035112501 7:156494956-156494978 CCCTGTGTTTCATGATGTGAAAC No data
Right 1035112506 7:156495009-156495031 ACACCATCCTGTATCAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035112506 Original CRISPR ACACCATCCTGTATCAGAGA TGG Intergenic
No off target data available for this crispr