ID: 1035112507

View in Genome Browser
Species Human (GRCh38)
Location 7:156495012-156495034
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035112507_1035112513 2 Left 1035112507 7:156495012-156495034 CCATCCTGTATCAGAGATGGCCA No data
Right 1035112513 7:156495037-156495059 CCTTGTATTTCCTAGAGCAGGGG No data
1035112507_1035112510 0 Left 1035112507 7:156495012-156495034 CCATCCTGTATCAGAGATGGCCA No data
Right 1035112510 7:156495035-156495057 CACCTTGTATTTCCTAGAGCAGG No data
1035112507_1035112511 1 Left 1035112507 7:156495012-156495034 CCATCCTGTATCAGAGATGGCCA No data
Right 1035112511 7:156495036-156495058 ACCTTGTATTTCCTAGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035112507 Original CRISPR TGGCCATCTCTGATACAGGA TGG (reversed) Intergenic
No off target data available for this crispr