ID: 1035112513

View in Genome Browser
Species Human (GRCh38)
Location 7:156495037-156495059
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035112507_1035112513 2 Left 1035112507 7:156495012-156495034 CCATCCTGTATCAGAGATGGCCA No data
Right 1035112513 7:156495037-156495059 CCTTGTATTTCCTAGAGCAGGGG No data
1035112503_1035112513 23 Left 1035112503 7:156494991-156495013 CCTCCACACCTAGCATGTACACC No data
Right 1035112513 7:156495037-156495059 CCTTGTATTTCCTAGAGCAGGGG No data
1035112504_1035112513 20 Left 1035112504 7:156494994-156495016 CCACACCTAGCATGTACACCATC No data
Right 1035112513 7:156495037-156495059 CCTTGTATTTCCTAGAGCAGGGG No data
1035112508_1035112513 -2 Left 1035112508 7:156495016-156495038 CCTGTATCAGAGATGGCCACACC No data
Right 1035112513 7:156495037-156495059 CCTTGTATTTCCTAGAGCAGGGG No data
1035112505_1035112513 15 Left 1035112505 7:156494999-156495021 CCTAGCATGTACACCATCCTGTA No data
Right 1035112513 7:156495037-156495059 CCTTGTATTTCCTAGAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035112513 Original CRISPR CCTTGTATTTCCTAGAGCAG GGG Intergenic
No off target data available for this crispr