ID: 1035113130

View in Genome Browser
Species Human (GRCh38)
Location 7:156501136-156501158
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 629
Summary {0: 7, 1: 67, 2: 127, 3: 143, 4: 285}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035113130_1035113135 23 Left 1035113130 7:156501136-156501158 CCCCATTGCTTATTTTGTCAGGT 0: 7
1: 67
2: 127
3: 143
4: 285
Right 1035113135 7:156501182-156501204 GATGTGTGGTGTTATTTCTGAGG 0: 2452
1: 4225
2: 3706
3: 4758
4: 4612
1035113130_1035113134 9 Left 1035113130 7:156501136-156501158 CCCCATTGCTTATTTTGTCAGGT 0: 7
1: 67
2: 127
3: 143
4: 285
Right 1035113134 7:156501168-156501190 ATCAGATGGTTGTAGATGTGTGG 0: 4372
1: 5112
2: 8328
3: 3977
4: 2156
1035113130_1035113133 -5 Left 1035113130 7:156501136-156501158 CCCCATTGCTTATTTTGTCAGGT 0: 7
1: 67
2: 127
3: 143
4: 285
Right 1035113133 7:156501154-156501176 CAGGTTTGTCAAAGATCAGATGG 0: 5728
1: 3902
2: 2458
3: 1806
4: 2520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035113130 Original CRISPR ACCTGACAAAATAAGCAATG GGG (reversed) Intergenic
905712010 1:40113176-40113198 ATCTAACAAAAAAAGCAATGGGG + Intergenic
906176416 1:43777503-43777525 ACCTGACAAAACAAGCAATGGGG + Intronic
906499971 1:46334580-46334602 ACCTGAAAAAAAAAGCAGGGGGG - Intergenic
906571065 1:46841028-46841050 GCTTGACAAAATAAGCAATGGGG - Intergenic
906575015 1:46880939-46880961 ACCTGACAAAAAAATAAATGGGG + Intergenic
906600210 1:47120276-47120298 GCTTGACAAAATAAGCAATGGGG + Intergenic
906834586 1:49069496-49069518 CACTGACAAAACAAGCAAGGGGG - Intronic
906897335 1:49790056-49790078 ACCTGACAAAAAAAGCAATGGGG + Intronic
907723561 1:56997559-56997581 ACATGACAAAAAAAGGAAAGGGG + Exonic
908503830 1:64774441-64774463 ACCTGCCAAAACAAGCGATGGGG - Intronic
908629076 1:66082158-66082180 ACCTGATGAAGTATGCAATGAGG - Intronic
908735865 1:67276294-67276316 ACCTGACAAAAAAAGCAATGGGG + Intergenic
908933474 1:69344650-69344672 ACCTGACAAAAACAGCAATGGGG - Intergenic
908939675 1:69416570-69416592 ACCTGACAAAAACAGCAATAGGG - Intergenic
909678232 1:78261975-78261997 ACCTGAAAAAGCAAGCAATGGGG + Intergenic
911296753 1:96126828-96126850 ACCTATCAAAATCATCAATGAGG - Intergenic
911540915 1:99157419-99157441 ACCTGACAAAAACAGCAATGGGG - Intergenic
911675337 1:100652466-100652488 ACCTGACAAAACAAGCAATGGGG + Intergenic
911822059 1:102435498-102435520 ACCAGAGAAACTAAGCAATTGGG - Intergenic
911932310 1:103920609-103920631 GCCAGCAAAAATAAGCAATGAGG - Intergenic
912019767 1:105093193-105093215 ACCTGATAAAACAAGCAGTAAGG + Intergenic
912034301 1:105291906-105291928 ACCTGACAAAACAAGAAATGAGG - Intergenic
912656943 1:111494872-111494894 AACTGACAAAACAAGCAGTGGGG + Intronic
913399065 1:118407994-118408016 CCCTGACAAAAACAGCAATGGGG + Intergenic
914842146 1:151257204-151257226 AGCTGACAAAACAAGCAGTGAGG - Intronic
915011508 1:152691084-152691106 ACCTGACCAAAAAAGCAATGGGG + Intergenic
915024851 1:152818015-152818037 TCCTGACAAAATAAGAAATGGGG - Intergenic
915444730 1:155968082-155968104 ACCTGACAAAATTCCCAATCCGG - Intronic
915846657 1:159273422-159273444 ACCTGACAAAAAAAGCAATAAGG + Intergenic
916621455 1:166502519-166502541 ACCTGACAAAAACAAAAATGGGG + Intergenic
917272177 1:173289170-173289192 ACCTCTAAAAATATGCAATGTGG + Intergenic
917389089 1:174513296-174513318 ACCTGAAAAAATAAACTTTGAGG + Intronic
917528604 1:175812191-175812213 ACCTGACAAAAAAAGCAATGGGG + Intergenic
917714080 1:177716273-177716295 ATCTGACAAAACAAGAAATGGGG + Intergenic
917856821 1:179108005-179108027 AGCAGACAAAATCAGCAAAGAGG - Exonic
917984265 1:180298813-180298835 ACATGACAGCATAAACAATGAGG + Intronic
918947875 1:191093236-191093258 AGGCGACAAAATAAGCAATGAGG + Intergenic
919154721 1:193749094-193749116 ACCTGACAAAAACAACAATGGGG - Intergenic
919235143 1:194831260-194831282 AGCTGACAAAGAAAGCAATGGGG + Intergenic
919354635 1:196505349-196505371 ACCTGAGAAAACAAGCAATGGGG - Intronic
921292918 1:213675508-213675530 ACCAACAAAAATAAGCAATGGGG - Intergenic
921336293 1:214090095-214090117 AACTGAAAAAACAAGCCATGGGG - Intergenic
921438379 1:215154844-215154866 ATCTGACAATAAAAGAAATGGGG - Intronic
922040761 1:221894007-221894029 ATCAGCAAAAATAAGCAATGAGG + Intergenic
924307485 1:242705668-242705690 ACCTTACAAAAACAGCAATGAGG + Intergenic
924613716 1:245594433-245594455 ACCTGACAAAACAAGCAATGGGG - Intronic
924639597 1:245821272-245821294 ACCTGACAAAAGAAGCAATGGGG + Intronic
924876178 1:248106840-248106862 ACCAGACAAAACAAGCAATGGGG - Intergenic
924884106 1:248193826-248193848 ACCTGACAAAAAAAGCAATGGGG + Intergenic
924912306 1:248527256-248527278 ACCTGACAAAACAAGAAATAGGG - Intergenic
924919015 1:248606485-248606507 AGCTTAAAACATAAGCAATGGGG - Intergenic
1062953143 10:1520640-1520662 AGCAGACAAACTAAGCAATGTGG - Intronic
1063880274 10:10524135-10524157 ACCTAAAATAATAAGAAATGGGG + Intergenic
1064510466 10:16084275-16084297 ATCTGCTAAAACAAGCAATGGGG - Intergenic
1065691898 10:28342782-28342804 AGCTGACAAAATAAGCGATAGGG - Intergenic
1066165087 10:32778444-32778466 CCCAGAAAAAATAAGCAATAGGG - Intronic
1066453108 10:35549210-35549232 ACCTGGCAAAATAAGCCACAAGG + Intronic
1066608835 10:37212829-37212851 AACTGAAAAAAAAAGCAATGGGG - Intronic
1067207035 10:44227223-44227245 ACTTGACAAAACAAGCAATGGGG - Intergenic
1067958718 10:50823262-50823284 ACATAATAAAATAAGCCATGTGG - Intronic
1069443611 10:68452543-68452565 CCCTGGAAAAAGAAGCAATGTGG + Intronic
1070413541 10:76167518-76167540 ATTGGACAAAACAAGCAATGGGG - Intronic
1071488395 10:86118962-86118984 ACCTGACAACTAATGCAATGTGG + Intronic
1072220679 10:93325213-93325235 CACTGACAAAATAATCTATGTGG - Intronic
1072373413 10:94789609-94789631 ACCTGACAAAAAAAGAAATAGGG - Intronic
1072408197 10:95174516-95174538 ACCTGACAAAACAAGCAATGGGG - Intergenic
1073927127 10:108530184-108530206 ACCTGACAAAACAAGCAATGGGG + Intergenic
1074013793 10:109511644-109511666 AGCTGACAAAACAAGCATTAGGG - Intergenic
1074612160 10:115032334-115032356 AGTTGACAAAATAAGCAATGAGG - Intergenic
1074804544 10:117035377-117035399 AACTGACAAAAGAAACATTGGGG + Intronic
1075655567 10:124158825-124158847 ACCTCCCAGAATAAGCAATGGGG - Intergenic
1075814178 10:125251960-125251982 ACCTGCCAGAACAAGAAATGGGG - Intergenic
1077783704 11:5359869-5359891 ACCTGACAAAAAAAACAAATGGG + Intronic
1078120095 11:8498808-8498830 ACCTGACACAAACAGCAATGGGG + Intronic
1078278074 11:9870580-9870602 ACCTGACAGAACAAGCAATGGGG + Intronic
1078813628 11:14797128-14797150 ACCTGACACAACAAGCAATGGGG - Intronic
1080405233 11:31972777-31972799 ACCTGACAAAGTAATCTATGTGG - Intronic
1081010615 11:37806769-37806791 ACATGACAAGAAAAGCTATGAGG + Intergenic
1081035027 11:38133474-38133496 ACCTGACAAAATAAGGAATGGGG + Intergenic
1081225567 11:40517986-40518008 ACCTGACAAAATAAGCAATGGGG + Intronic
1081402045 11:42654699-42654721 ACCTGACAAAACAAGCAATGGGG - Intergenic
1082753318 11:57046028-57046050 ACCTGATAAAAAAAGCAATGGGG + Intergenic
1082871698 11:57948817-57948839 ACCTGAAAAAACAAGCAATGGGG - Intergenic
1084437275 11:69151057-69151079 AACTGACAAAAAAAGCAATGGGG + Intergenic
1086041272 11:82482334-82482356 ACCAGACAAAACAAGCAATGGGG - Intergenic
1086418434 11:86613172-86613194 ACCTGAAAAAATAAGCAATGGGG - Intronic
1087573686 11:99963423-99963445 ACCTGACAAAAAAAGAAATGGGG - Intronic
1087663029 11:101009710-101009732 TCCTCACAAAACAAGCAATTTGG - Intergenic
1087668251 11:101075196-101075218 ATCTGACCAAAAAAGCAATGGGG + Intronic
1087741907 11:101897620-101897642 ACCTGACAAAAAAAGCAATGGGG - Intronic
1088052118 11:105529709-105529731 AGCTGGCAAAACAAGCAATGAGG + Intergenic
1088061470 11:105656247-105656269 ACCTGACAAAATGAGCAATGGGG + Intronic
1088176344 11:107056747-107056769 AACTGACAAAACAAGCAATGGGG + Intergenic
1088690936 11:112326881-112326903 ACCTGACAAAATAAGCAACAGGG - Intergenic
1090741298 11:129663320-129663342 ACCTGAAAAAACAAGCGATGGGG + Intergenic
1091030487 11:132183069-132183091 AGTTGACAATATATGCAATGAGG - Intronic
1091050872 11:132369769-132369791 ACCTGACAAAAACAAGAATGGGG + Intergenic
1092725447 12:11481053-11481075 GATTGACAAAATAAACAATGAGG + Intronic
1093544609 12:20331904-20331926 ACCTGACAAAAAAAGCAATGGGG - Intergenic
1093855917 12:24102030-24102052 CCCTGACATAACAAACAATGAGG + Intergenic
1094124196 12:27005743-27005765 ACTTGACAAAATAAGTAGGGGGG + Intronic
1094370619 12:29733677-29733699 ACCTGACAAAATTTGCAGTCAGG + Intronic
1094393120 12:29974937-29974959 ACCTGACAAAAACAAAAATGGGG - Intergenic
1095104198 12:38212060-38212082 ACCTGACAAAAACAAGAATGGGG + Intergenic
1095105305 12:38226766-38226788 ACCTGACAAAAACAAGAATGGGG - Intergenic
1095914648 12:47465048-47465070 ACCTGACAAAACAAGCAATGGGG - Intergenic
1096736614 12:53660463-53660485 AACTCAGAAAATAAGCAGTGGGG + Intronic
1097422282 12:59394909-59394931 ACATGACAAAAAGAGAAATGGGG + Intergenic
1098892233 12:76021189-76021211 ACTTGAAAAAATAGTCAATGCGG - Intergenic
1099994065 12:89757662-89757684 ACTGTCCAAAATAAGCAATGAGG + Intergenic
1100138062 12:91579397-91579419 TTCTGAGAAAATAAGCACTGAGG - Intergenic
1100750427 12:97692575-97692597 ACCTGACAAAACAAGAAATGGGG - Intergenic
1101069398 12:101058127-101058149 ACCTGACAAAAACAGCAATGGGG - Intronic
1102107420 12:110337288-110337310 ACCTCACCAAACAAGCCATGGGG - Intronic
1102163191 12:110785926-110785948 ACCTGGCAAAGTAAACACTGTGG + Intergenic
1102828774 12:115975312-115975334 ACCTAACAAATAAAGAAATGGGG + Exonic
1102832354 12:116015273-116015295 ACCTGAAAAAAAAGGCAATTTGG + Exonic
1103102250 12:118188281-118188303 ATCTGACAAAAGAAGAAATACGG - Intronic
1103254155 12:119526139-119526161 AGGTGACAAAACAAGCAATGGGG + Intronic
1107158747 13:37200177-37200199 ACCAACAAAAATAAGCAATGGGG - Intergenic
1107203889 13:37757086-37757108 ACATTAAAAAATATGCAATGTGG + Intronic
1107232665 13:38129398-38129420 AGTTGACAAAACAAGCAATGAGG - Intergenic
1107397924 13:40037463-40037485 ATTTGACAAAACAAGCAATGAGG - Intergenic
1107615698 13:42164770-42164792 AGCTGAGAAAATAAGCATGGGGG + Intronic
1108985113 13:56576939-56576961 ACCTGAGAAAACAAGCAATGGGG + Intergenic
1109161679 13:58983098-58983120 ACCTGACAAAAACCGCAATTGGG - Intergenic
1109388093 13:61658672-61658694 ACCTCGCAAAACAAGCAATGGGG - Intergenic
1110071711 13:71186002-71186024 ACCTGACAAAACAAGAAATGGGG + Intergenic
1111434855 13:88193169-88193191 ACCTGACAAAACAAGAAATGGGG - Intergenic
1111960689 13:94806811-94806833 GCATGAAAAAATAAGCTATGTGG - Intergenic
1111967517 13:94875953-94875975 ACCTGACAGAACAAGAAATGGGG + Intergenic
1112371345 13:98796453-98796475 CCCTCACAAAAAAAACAATGTGG + Intronic
1113488551 13:110674441-110674463 ACCTGACAAAAAAAGAAATGGGG + Intronic
1114191363 14:20441711-20441733 ACCTGAAAGGAGAAGCAATGAGG - Intergenic
1115915325 14:38306027-38306049 AGCTGACAGAGCAAGCAATGGGG + Intergenic
1115947251 14:38676024-38676046 ACCTGACAAAACAAGAAATGGGG + Intergenic
1116026258 14:39519104-39519126 ACCAACAAAAATAAGCAATGGGG + Intergenic
1116354050 14:43905107-43905129 ACCTGACAAAACAAGCACTGGGG - Intergenic
1116395264 14:44440872-44440894 AGTTGACAAAATAAGCAAAGAGG + Intergenic
1116671727 14:47850835-47850857 ACCAGACAAAACAAGCAATGGGG + Intergenic
1117030334 14:51662524-51662546 ACCTGACAAAACAAGCAATGGGG + Intronic
1117043991 14:51794238-51794260 TTCTGACAAAATACGAAATGGGG + Intergenic
1117386466 14:55218805-55218827 AACAGAAAAAAAAAGCAATGAGG - Intergenic
1117640249 14:57790860-57790882 ACCTGACAAAAAATGCAATGGGG + Intronic
1117655888 14:57956166-57956188 ACCTAACAAAACAAGAAATGGGG + Intronic
1117893069 14:60447919-60447941 ACCTGACAAAAACAGCAACGGGG + Intronic
1118082396 14:62375860-62375882 CCCTGACAATATAAGTAATGTGG - Intergenic
1118579011 14:67274387-67274409 ACCTGACAAAAACAAAAATGGGG - Intronic
1120563397 14:86024734-86024756 ACCTGACAAAAAAAGAAATGGGG - Intergenic
1121072972 14:91041773-91041795 ACCTGACAATAAGAGCAAAGTGG - Intronic
1122833111 14:104413293-104413315 ACCTGACAAAAAAAGAAATGGGG - Intergenic
1123157629 14:106244170-106244192 ACCTGACAAAACAAGAAATGGGG - Intergenic
1123179406 14:106454272-106454294 GGCTGACAAAACAAGCAATGGGG - Intergenic
1123221149 14:106857128-106857150 ACCTGACAAAAACAGCAATGGGG - Intergenic
1124595296 15:31086779-31086801 ATCTGACAACCTATGCAATGTGG + Intronic
1125274170 15:37973041-37973063 AGTTGACAAAACAGGCAATGGGG - Intergenic
1125996751 15:44168977-44168999 ACCTGAAGTAATAAGCGATGGGG - Intronic
1126278039 15:46907786-46907808 ACCTGGAAAAACAAGCAATGAGG - Intergenic
1126826436 15:52554106-52554128 TTCTGACAAAATAAGAAATTTGG - Intronic
1127185641 15:56477084-56477106 ACCTGAAAAAAAAAGAAATGGGG - Intergenic
1127778873 15:62293932-62293954 AGCTGAGAAAACAAGCAATGGGG + Intergenic
1128707124 15:69844423-69844445 ACCTCACAAGATAAGCAAGCAGG + Intergenic
1130779570 15:87021219-87021241 ACCCGACAAATCCAGCAATGGGG + Intronic
1132474753 16:128877-128899 ACGTGACAAAATAAACCAGGAGG + Intronic
1133886236 16:9830608-9830630 ACCTGCCAATATAAGCAGAGTGG + Intronic
1134188552 16:12103418-12103440 ACCTGACAAAATAAGCAATGGGG + Intronic
1135376179 16:21949383-21949405 ACCTGTGAAAATAAGCTATCAGG + Intergenic
1136600118 16:31280002-31280024 ACCTGAAAAAACAAGAAATGGGG - Intronic
1138924758 16:61577308-61577330 ACCTAATATTATAAGCAATGAGG - Intergenic
1139131880 16:64156615-64156637 CCCTGACAAAACAAGACATGGGG + Intergenic
1141400493 16:83742905-83742927 ACCAAACAAAATAAGCAAACTGG + Intronic
1142526396 17:544774-544796 ATCTAAGAAAATAAGCAATATGG + Intronic
1143650127 17:8258165-8258187 AGCTGACCACATAAGCAAGGAGG + Exonic
1144383084 17:14722317-14722339 AGCTGACAAAACAAGTAATGGGG + Intergenic
1146622477 17:34409783-34409805 AGCTGACAAAAACAGCAATGGGG + Intergenic
1146743698 17:35309066-35309088 ACCTGATAAAACAAGCAATGGGG + Intergenic
1146765537 17:35517774-35517796 AACTGACAAAACAAACAATGGGG + Intronic
1147860292 17:43517054-43517076 AACTGGCAAAATCAGAAATGGGG - Intronic
1148320626 17:46748801-46748823 ACCTGGTAAACTAAGCAAAGGGG + Intronic
1148980440 17:51569550-51569572 ACCTGACAAAAAAAAGAATAGGG - Intergenic
1149235447 17:54584970-54584992 AGCTGAGAAAACAAGCAATAGGG + Intergenic
1149253672 17:54799909-54799931 ACCTGACACACACAGCAATGGGG + Intergenic
1150885056 17:69075508-69075530 AACAGACAAAATAAGCAATCGGG - Intergenic
1151071843 17:71223062-71223084 ACCTGACAAAATAATCACTATGG + Intergenic
1153542271 18:6168553-6168575 ACCTGAGAAAAAAAGCAATGGGG + Intronic
1153701921 18:7702943-7702965 ACCTGACAAAAACAGCAATGGGG - Intronic
1153801815 18:8677891-8677913 AACTGGCAAAATAAGCAAAAAGG + Intergenic
1154029134 18:10735676-10735698 AACAGACACAAGAAGCAATGGGG + Intronic
1154288144 18:13079901-13079923 ACCTGACAAAAAAAGAAATGGGG - Intronic
1154288740 18:13085659-13085681 ACTTGACAAAACAAGAAATGGGG - Intronic
1154402957 18:14059600-14059622 ACCTAGCAAAATAAGCAGGGGGG - Intronic
1155735729 18:29220161-29220183 ACCTGACAAAAAAAGAAATGGGG + Intergenic
1155856887 18:30845530-30845552 ACCTGACAAATCAAGCAAGGGGG - Intergenic
1155861636 18:30908981-30909003 AGTTGACAAAAAAAGCAATGGGG + Intergenic
1156402315 18:36750749-36750771 AGCTGACAAAACAAGCAATGGGG - Intronic
1156551015 18:38016805-38016827 ACCTGACAAAACAAGCAATGGGG - Intergenic
1156751173 18:40457560-40457582 ACAAAACAAAATAAGCTATGAGG + Intergenic
1157396890 18:47349492-47349514 ACCTGGAAAAACAAGCAATGGGG - Intergenic
1157413399 18:47482415-47482437 GCCCCACAAAATAAGAAATGTGG - Intergenic
1158078347 18:53559017-53559039 AGTTGATAAAATAAGCAATGAGG + Intergenic
1158095776 18:53768953-53768975 ACCTGACAAAACAAGCAATGGGG + Intergenic
1158098430 18:53802143-53802165 ACCTGACAAAAACAGCAATCAGG - Intergenic
1159146125 18:64456626-64456648 ACCTGACAGAAACAACAATGGGG + Intergenic
1164266029 19:23618377-23618399 ACCTGACAAAAAAAGAAATGGGG + Intronic
1164400839 19:27901195-27901217 ACAGAACAAAGTAAGCAATGTGG + Intergenic
1164866531 19:31608901-31608923 GCCTGAGAAAGAAAGCAATGTGG + Intergenic
1166433352 19:42745212-42745234 ACTTGAGAAAACAAGCAATGGGG - Intronic
1166632801 19:44422137-44422159 ACCTGACAAAAAAAGCAATGGGG - Intronic
1168602752 19:57732147-57732169 ACCTGAAAAAACAAACAATGGGG + Intronic
925053793 2:839450-839472 ACCTGACAAAAACAGCAATGGGG + Intergenic
925133044 2:1507149-1507171 ACCTGACAAAAACAACAATGGGG - Intronic
925647356 2:6050024-6050046 AGCTGACAAAAAAAGCAATGGGG + Intergenic
927015501 2:18955949-18955971 ATCTGACCAAAAAAGCAATGGGG + Intergenic
928258609 2:29746889-29746911 ACATGACGAAATAAGCCATGAGG + Intronic
928486898 2:31741427-31741449 ACCTGACAAAACAAGAAATGGGG - Intergenic
928488003 2:31752185-31752207 ACCTGACAAAACAAGAAATGGGG + Intergenic
929062467 2:37937169-37937191 ACCTGACAAAAACAGCAATAGGG - Intronic
929358570 2:41055578-41055600 ACCTGACAAAAAAAGAAATAGGG - Intergenic
930127900 2:47817412-47817434 CCCTGAGAAACTAAGCAATAAGG + Intronic
930270173 2:49247045-49247067 ACCTGACAAAATAAAAAATGGGG + Intergenic
930433684 2:51313970-51313992 ACCTCAGAAAACAAGCAATGGGG - Intergenic
930598693 2:53418906-53418928 ATCTGACAAAACAAGCAATGGGG - Intergenic
930789184 2:55306213-55306235 ATCTTACCAAATAAGAAATGGGG - Intronic
930813769 2:55570336-55570358 ACCTGGCTAAATATGCACTGTGG + Intronic
930933354 2:56916837-56916859 ACCTGACAAAACAAGCAATGGGG + Intergenic
931153810 2:59604922-59604944 ACCTTACATAATTAGAAATGTGG + Intergenic
931420991 2:62127602-62127624 ACCTGACAAAAAAAGCAATGGGG + Intronic
931750080 2:65322625-65322647 CCCTGGCAAAAGATGCAATGAGG - Intronic
931846661 2:66211099-66211121 ACCTGAGAAAACAAGCAATGGGG + Intergenic
932523595 2:72440165-72440187 ACCTGCTAAAATAAGCAGTCTGG + Intronic
933944253 2:87271252-87271274 ACCTGACAAAACAAGAAATGGGG - Intergenic
935003280 2:99042998-99043020 ATCTTACAAAATAAAGAATGGGG - Intronic
935020706 2:99228283-99228305 ACCTGACAAAACAAGAAATGGGG + Intronic
935063418 2:99627836-99627858 CTTTGACAAAAGAAGCAATGGGG - Intronic
935451670 2:103216636-103216658 ATCTGACAAAAACAACAATGGGG + Intergenic
935835069 2:107041880-107041902 GCTTGCAAAAATAAGCAATGAGG + Intergenic
936335963 2:111590327-111590349 ACCTGACAAAACAAGAAATGGGG + Intergenic
936947521 2:117943911-117943933 ACTAGAGAAAATAAGTAATGAGG - Intronic
939028352 2:137040742-137040764 AGCTGACCACATAAGCCATGGGG - Intronic
940680983 2:156784540-156784562 AGCTGACAAAATCAGCCAGGGGG + Intergenic
941215654 2:162705199-162705221 CCATGACAGAATATGCAATGTGG - Intronic
941278704 2:163523166-163523188 ACTGGAAAAAAGAAGCAATGGGG - Intergenic
941762756 2:169262971-169262993 ACCTGAGAAAAAAAGCAATGGGG + Intronic
941839300 2:170062723-170062745 AAATGACAAAATAAGCCATAAGG - Intronic
942362921 2:175191605-175191627 ACCTGACAAAATAAGAAATGGGG + Intergenic
942429489 2:175895211-175895233 ACCTGACAAAAATGGCAGTGGGG + Intergenic
942755056 2:179330677-179330699 CTTTGACAAAACAAGCAATGAGG + Intergenic
943136067 2:183914409-183914431 ACCTGAGAAAAACAGCAATGGGG - Intergenic
943232406 2:185271614-185271636 ACCTGACAAAACAAGCAATGGGG - Intergenic
943455989 2:188107716-188107738 AATTGACAAAGCAAGCAATGGGG + Intergenic
943555827 2:189402658-189402680 ACCTGACAAAAGCAACAATGGGG - Intergenic
943890354 2:193278149-193278171 ACCTGACAGAAAAAAAAATGAGG + Intergenic
944439745 2:199730077-199730099 ACCTGACAAGAACAACAATGGGG + Intergenic
945461300 2:210112221-210112243 ACCTAACAAAAACAGCAATGGGG + Intronic
945830898 2:214783745-214783767 ACCTAACAAAACAAGCAATGGGG + Intronic
946019178 2:216628557-216628579 AGTTGAGAAAATAAGCAATGGGG - Intergenic
946639613 2:221769383-221769405 AAATGACAAAATAAGCTTTGAGG - Intergenic
946783440 2:223217587-223217609 TCCTGACAAAGCAAGCTATGGGG - Intergenic
947688204 2:232109603-232109625 ACCTGACAAAATAAGCAAGGGGG + Intronic
947978649 2:234388975-234388997 ACCTGACAAAACAAGCAACGGGG + Intergenic
948240011 2:236422927-236422949 ACCTGAAAAAACAAGAAATGGGG + Intronic
948610038 2:239161077-239161099 ACCTCACAAAAAAAGGCATGGGG - Intronic
1169678193 20:8178898-8178920 AGTCGACAAAACAAGCAATGGGG - Intronic
1170228933 20:14023665-14023687 ACCTGACTAAACAAGCAATGGGG - Intronic
1170925571 20:20720010-20720032 ACATGACAAAGTAAGCAAAATGG + Intergenic
1171274060 20:23840341-23840363 ACCTGACAAAAACAAAAATGGGG + Intergenic
1171575083 20:26302347-26302369 ACCTGAGAAAACAAGCAACGGGG - Intergenic
1173055635 20:39609801-39609823 ACCTGACAAAACACGCAATGGGG + Intergenic
1174373249 20:50108439-50108461 ACCTCAGAGAATAAGAAATGGGG + Intronic
1174848407 20:53967070-53967092 ACCTGGCAAAATAATCCAGGTGG - Exonic
1176909001 21:14540018-14540040 ACCTGAGAAAACAAGCAATGGGG + Intronic
1177058431 21:16339019-16339041 AGCTGACAAAATAATCATAGTGG - Intergenic
1177388575 21:20438090-20438112 AACTGACAAAAAAAGCTATGGGG + Intergenic
1177463795 21:21447276-21447298 ACCTGACAAAACAAGCAATGGGG + Intronic
1177544579 21:22539908-22539930 GGTTGACAAAAAAAGCAATGAGG + Intergenic
1177574417 21:22932671-22932693 AATCAACAAAATAAGCAATGGGG - Intergenic
1177951361 21:27542079-27542101 ATCTGACAAAACAAGTAATGGGG + Intergenic
1179121775 21:38553559-38553581 AGTAGACAAAACAAGCAATGTGG + Intronic
1180524271 22:16239907-16239929 ACCTGCAAAAACAAGCAATGGGG + Intergenic
1181627272 22:24130466-24130488 ACCTCACAGAATTACCAATGAGG - Intronic
1182761742 22:32727966-32727988 ACCTGACCAAACAAGCAATGGGG + Intronic
949432773 3:3995601-3995623 ACCTGACAAAACAAGCAATGAGG - Intronic
951070411 3:18321753-18321775 AGCTGATAAAACAAGCAATGAGG - Intronic
951197670 3:19842169-19842191 ACCTGACAAAACAAGTAATGGGG - Intergenic
952010010 3:28889874-28889896 ACCTGACAAAAAAAGCAATGGGG - Intergenic
952522235 3:34173086-34173108 ACCTGACAAAACAAGCAATGGGG - Intergenic
952863242 3:37832484-37832506 ACCTGAAAAAATAAAACATGAGG + Intergenic
952998994 3:38913758-38913780 AGCTGACAAAACAAGCAATGAGG - Intronic
953116620 3:39998903-39998925 ACCTGACAAAACAAGCAATGGGG + Intronic
953287092 3:41621490-41621512 ACCTGACAAAAACAAAAATGGGG + Intronic
953721450 3:45358896-45358918 AGTTGACAAAACAAGCAATGGGG - Intergenic
954525460 3:51266554-51266576 ACCTGACAAAAGAAGCAATGGGG + Intronic
954998015 3:54899789-54899811 ACCAGTCAATAAAAGCAATGTGG + Exonic
955439036 3:58935649-58935671 ACCTGAGAAAAACAGCAATGGGG + Intronic
955637684 3:61047851-61047873 ACATGAAAAAACAAGCAATGGGG + Intronic
955854683 3:63260446-63260468 ACCTGACAAAACAAGAAATGGGG + Intronic
956321453 3:68001264-68001286 GACAGACAAGATAAGCAATGAGG + Intergenic
956940474 3:74155094-74155116 ACATGAGAAAAAAAGCAAAGTGG + Intergenic
957632776 3:82739281-82739303 ACCTGGCAGAAAAAGAAATGAGG - Intergenic
957688513 3:83536947-83536969 ACCTGAAAAAAAAAGAAATGGGG + Intergenic
957721855 3:84012473-84012495 ACCTGACAAAATAAGAAATGGGG + Intergenic
957739861 3:84250450-84250472 ACCTAACAAAATAAGCAATAGGG - Intergenic
958450330 3:94265253-94265275 TCCTGACAAAATAAGGGACGTGG + Intergenic
958746707 3:98144612-98144634 ATCTGACAAAAAGTGCAATGGGG + Intergenic
959119876 3:102220684-102220706 ACCTGACAAAACAAGCAACGGGG - Intronic
959203415 3:103276867-103276889 ACTGAACAAAACAAGCAATGAGG - Intergenic
959494804 3:107037830-107037852 ACCTGATAAAACAAGTAATGGGG + Intergenic
959642789 3:108660364-108660386 ACCTGACAAAAACAGAAATTGGG + Intronic
959775240 3:110151708-110151730 ACATGACAAAACAACCAACGAGG - Intergenic
959829597 3:110844569-110844591 ACCTAACAAAAAAAGCAATGGGG + Intergenic
959947662 3:112144013-112144035 AGTTGACAATACAAGCAATGGGG - Intronic
959986165 3:112573792-112573814 ACCTGACAAAAAAAGCTTTTTGG - Intronic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
960343273 3:116501306-116501328 AACTGAAAAAACAAGCAATGGGG + Intronic
961583859 3:127905884-127905906 ACCTGACAAAATAAGCAATGGGG + Intergenic
963307285 3:143667207-143667229 ACCTGACCAAAAAAGAAATGGGG + Intronic
963381859 3:144540676-144540698 AATTGACAAAATAAGCAATGGGG + Intergenic
963387507 3:144615873-144615895 ACCTCAAAAAACAAGCAATGGGG - Intergenic
963460975 3:145614771-145614793 ACCGACCAAAACAAGCAATGGGG - Intergenic
963694251 3:148544837-148544859 ACCTGACAAAAAAAGCAATGAGG + Intergenic
964179796 3:153869141-153869163 ACCTGACAAAAACAAAAATGGGG - Intergenic
964241071 3:154595349-154595371 ACCTGAGAAAACAAGCAATGGGG - Intergenic
964695518 3:159503522-159503544 ACCTGACAGTAAAAGCCATGAGG + Intronic
964780063 3:160327553-160327575 ACCTGACAAAACAAGCAATGAGG + Intronic
965417421 3:168414436-168414458 AACTGAAACTATAAGCAATGGGG - Intergenic
965621494 3:170646395-170646417 ACCTGACAAAAACAAGAATGGGG - Intronic
965808563 3:172568198-172568220 AGCTGACAAAACAAGCAATGGGG - Intergenic
965930461 3:174036717-174036739 ATCTGAAAAAATAACTAATGGGG - Intronic
966269608 3:178089368-178089390 AATTGACAAAATAAGAAATTGGG + Intergenic
966291612 3:178366007-178366029 ACCTGACAAAACAAGAAATGGGG + Intergenic
967212888 3:187184515-187184537 ACATCACAAAAGAAGCAAAGAGG - Intergenic
969852375 4:9970138-9970160 ACCTGATAATATAGGCCATGGGG + Intronic
970012652 4:11476846-11476868 AGCTGACAAAACAAACAATGAGG + Intergenic
970210003 4:13699631-13699653 AGCTGACAAAATAAGCAATGGGG - Intergenic
970475823 4:16421869-16421891 ACCTGAGAAAACAAGCAATGGGG + Intergenic
971693936 4:29873474-29873496 ACCTGACAAAAGAAGAAATGGGG - Intergenic
971815243 4:31478422-31478444 GGCTGACAAAAAAAGCAATGGGG - Intergenic
971863884 4:32143716-32143738 ACCTGAAAAAACAAGCAATGAGG - Intergenic
972219751 4:36940465-36940487 ACCTGACAAAACAAGCAATGAGG + Intergenic
973098581 4:46232647-46232669 GCCTGCAAAAACAAGCAATGGGG - Intergenic
973114834 4:46442842-46442864 ACCTGATAAAATACTGAATGAGG - Intronic
973328429 4:48887602-48887624 ACCTGAAAAAACAAGAAATGGGG - Intronic
973683410 4:53344825-53344847 ACCTGAGAAAACAAGCAACGGGG + Intronic
973722505 4:53739512-53739534 ACCTGAGAAAACAAGCAATGGGG + Intronic
973826602 4:54713319-54713341 ACCTCACGAGCTAAGCAATGAGG - Intronic
974110463 4:57519786-57519808 ACCTGGCAAAAAAAGAAATGGGG + Intergenic
974531705 4:63116409-63116431 ACCTGACAAAGCAAGGCATGGGG - Intergenic
974539414 4:63214767-63214789 ATATGACAAAACAAGCAATGGGG - Intergenic
974562879 4:63544392-63544414 AGTTGAAAAAATAAGCAATGAGG + Intergenic
974649841 4:64741135-64741157 ACCTGAGAAAAACAACAATGGGG + Intergenic
974854264 4:67440765-67440787 ACCTGACAAAAACAAGAATGGGG + Intergenic
975007150 4:69304215-69304237 ACCATACAAAACAAGAAATGGGG + Intronic
975166124 4:71180077-71180099 ACCTGACAAAAACAAGAATGGGG + Intergenic
975483734 4:74911458-74911480 ACCTGACAAAAAAAACAATGGGG - Intergenic
975513181 4:75216271-75216293 ACCTGACAAAACAAGCAATAGGG - Intergenic
975739653 4:77417239-77417261 ACCTCAAAAAATAAGCCATTAGG - Intronic
976262306 4:83157399-83157421 AGCAGTCAAAATAAGCAATAAGG - Intergenic
976459256 4:85289026-85289048 ACTTAACTAAAAAAGCAATGGGG + Intergenic
976524486 4:86071657-86071679 ACCTGAGAAAAACAACAATGGGG - Intronic
977863557 4:101996192-101996214 CCTCGAAAAAATAAGCAATGGGG - Intronic
978117087 4:105032529-105032551 ACCTGACAAAACAAGAAATGGGG + Intergenic
978319688 4:107479768-107479790 ACCTGAAAACATTAGCAATATGG + Intergenic
978507338 4:109473756-109473778 AACTGCCAAAAGAAACAATGTGG - Intronic
978544283 4:109853851-109853873 ACCTGACAAAACAAGCAATGGGG - Intronic
978657291 4:111079425-111079447 ACCTGACAAAACAAGCAATAGGG + Intergenic
978744632 4:112178470-112178492 AGCAGACAAAACAAGCAATGGGG - Intronic
978750925 4:112246543-112246565 ACATGACGAAATCACCAATGTGG - Intronic
979338037 4:119486429-119486451 ACCTGACAAAAACAAGAATGGGG + Intergenic
979590224 4:122470640-122470662 ACATGACATAATGAGCAAAGTGG - Intergenic
979636943 4:122966546-122966568 ACCTGATAAAATAGGAATTGGGG - Intronic
979985822 4:127313130-127313152 ACCTGACACAGCAAGCAATGGGG + Intergenic
979998266 4:127459385-127459407 ACCTGACAAAAGAAGCAATGGGG - Intergenic
980198612 4:129624954-129624976 ACCTGACAAAACAAGAAATGGGG - Intergenic
980328963 4:131386550-131386572 AGCTGACAAAAACAACAATGGGG - Intergenic
980688036 4:136255759-136255781 ACCTGACAAAACAAACAATGGGG + Intergenic
980854326 4:138421308-138421330 ACCTTACAAAATAAGGAAGTGGG + Intergenic
980867414 4:138569636-138569658 ACCTGAAAAACCAAGAAATGGGG + Intergenic
981205240 4:142033182-142033204 ACCTGACCAATTCAGCAAAGAGG + Intronic
981302280 4:143201256-143201278 AGCTGTCAAAACAAGCAATGGGG + Intronic
981835790 4:149051791-149051813 ATCTGAAAAAATAAACAGTGAGG - Intergenic
982143776 4:152359298-152359320 AGGTGACAAGATAAGAAATGAGG + Intronic
982552223 4:156817348-156817370 AATTTACAAAATTAGCAATGAGG + Intronic
982686064 4:158490358-158490380 ACCTACAAAAACAAGCAATGGGG - Intronic
982792614 4:159610681-159610703 ACCTGAAAAAACAAGAAATGGGG - Intergenic
982810522 4:159820266-159820288 ACCTGCCAAAACAAGCAATGGGG + Intergenic
983018857 4:162649323-162649345 AGCTGACAAAACAAACAATGGGG - Intergenic
983030734 4:162798616-162798638 ACCTACAAAAACAAGCAATGGGG - Intergenic
983441557 4:167793061-167793083 AGTTGACAAAACAAGCAATGGGG - Intergenic
983571097 4:169208979-169209001 ACCAAACAAAATAAAAAATGAGG + Intronic
983958454 4:173724068-173724090 ACCTGACAAAACAAGCAACGGGG - Intergenic
985159750 4:187032245-187032267 ACCTGACAAAAACAGAAATGGGG - Intergenic
985233329 4:187845736-187845758 ACCTGACAAAAACAACAATGGGG + Intergenic
986172003 5:5322255-5322277 ACCTGAAAAAACAAGCAACGAGG - Intergenic
987019741 5:13857738-13857760 ACCTGACAAAACAAGCAATAGGG + Intronic
987229202 5:15875139-15875161 ACCTGATAAAACAAGCAGTGGGG + Intronic
987260848 5:16201295-16201317 ATTTGACAAAACAAGCAATGGGG + Intergenic
987464753 5:18258648-18258670 ATCTGAGAAAAAAAGCAGTGGGG + Intergenic
987560620 5:19515111-19515133 ACTTGACAAAACAATAAATGGGG - Intronic
987608573 5:20171987-20172009 AGCTTACAAAATAAGCAATGAGG - Intronic
987975832 5:25013903-25013925 ATCTGACAAAAACAGCAATGGGG + Intergenic
988063926 5:26210176-26210198 AGTTGACAAAATAAGCAATGGGG + Intergenic
988352671 5:30131629-30131651 ACCTGACAAAAAAAGCAATGGGG - Intergenic
988416985 5:30957844-30957866 TTCTGACAACATTAGCAATGAGG + Intergenic
988675558 5:33429343-33429365 ACCTGAAAAAACAAGCAATGAGG - Intergenic
989545891 5:42672494-42672516 AGATGACAAAATTAGCAATGGGG + Intronic
989656968 5:43754979-43755001 ACTTGACAAAATCAGCAATGGGG - Intergenic
989816532 5:45744336-45744358 ACCTGAGAAAAACAACAATGGGG - Intergenic
989848055 5:46171277-46171299 ACCTGACAAAACAAGAAATGGGG + Intergenic
989858988 5:46341629-46341651 ACCTGAGAAAACAAGCAATGGGG - Intergenic
990111917 5:52336883-52336905 ACCTGACCAAAAAAACAATGGGG - Intergenic
990138628 5:52677916-52677938 ACCTGACAAAAAAAGCAATGGGG - Intergenic
990175681 5:53105451-53105473 ACCTACAAAAACAAGCAATGGGG + Intronic
992611113 5:78509525-78509547 CCCCGAGGAAATAAGCAATGAGG + Intronic
992853870 5:80840281-80840303 ACCTGACAAAACAAGCAATGGGG + Intronic
992854077 5:80842170-80842192 ACCTGACAAAACAAGCAATGGGG - Intronic
993023226 5:82617055-82617077 ACCTGACAAAACAAGAAATGGGG + Intergenic
993081080 5:83301840-83301862 ACCTGAAAAAACAAGCAATGGGG - Intronic
993665295 5:90688271-90688293 ACCTGAGAAAAACAGCAATGGGG + Intronic
994344252 5:98665584-98665606 ACCTGACAGAAACAGCAATGGGG + Intergenic
994479053 5:100310019-100310041 ACCTAACAAAACAATCAATGGGG + Intergenic
994585645 5:101705834-101705856 TCTTGCAAAAATAAGCAATGGGG - Intergenic
994672250 5:102776600-102776622 ACCTGACAAAAACAACAATGGGG - Intronic
995163886 5:109014347-109014369 ACCTGACAAAAACAACAATGGGG - Intronic
995586142 5:113650673-113650695 ACCTGACAAAAAAAGAAATGGGG + Intergenic
996426201 5:123315789-123315811 ACCTGACAAAATAAGTCATGGGG - Intergenic
996641461 5:125760248-125760270 AATTGACAAAATAAGCAACAGGG - Intergenic
996648753 5:125847842-125847864 ACCTGACAATAAACTCAATGAGG + Intergenic
996687903 5:126304491-126304513 ACTTGACAAAACAACCAACGGGG + Intergenic
996902513 5:128558797-128558819 ACCTGAAAAAACAAGCAATAAGG + Intronic
996919036 5:128746005-128746027 ACCTCACCAAATAAACACTGAGG + Intronic
997188485 5:131905756-131905778 ATCTACCAAAACAAGCAATGGGG + Intronic
1000521934 5:162306029-162306051 ACCTGGCAAAAACAGCAATGGGG + Intergenic
1004293388 6:14388525-14388547 ATCTGACAAATTAAGAAACGGGG + Intergenic
1004760542 6:18661252-18661274 ACCTACAAAAACAAGCAATGAGG + Intergenic
1004922012 6:20384590-20384612 AATTTTCAAAATAAGCAATGAGG - Intergenic
1005277547 6:24236308-24236330 ATCAGCAAAAATAAGCAATGGGG + Intronic
1006712620 6:36088003-36088025 ACCTGACAAAACGAGCAATGGGG + Intronic
1008175731 6:48266031-48266053 ACCTGAAAAAGCAAGCAATGGGG - Intergenic
1008462751 6:51794785-51794807 ACCTCAAAAAACAAGCAGTGGGG - Intronic
1009709192 6:67295932-67295954 CCTTGACACAACAAGCAATGGGG - Intergenic
1009986487 6:70787175-70787197 ACCTGACAAAAGGAGCAATGGGG + Intronic
1010315392 6:74442951-74442973 ACCTGACAGAAATAGCAATGGGG - Intergenic
1010321557 6:74515986-74516008 ATTTGACAAAACAAGCAATGGGG - Intergenic
1010556070 6:77281340-77281362 ACCTGACAAAACAAGCAATGGGG + Intergenic
1011174446 6:84544503-84544525 ACCTGACAAAAAAAGCAATGGGG + Intergenic
1011830834 6:91369468-91369490 ACCTGACAAAACAAGCAATGGGG - Intergenic
1012591859 6:100991739-100991761 ACCTGACAAAAACAGCAATGGGG - Intergenic
1012719980 6:102728712-102728734 ACCCGACAAAACAAGCAATGGGG - Intergenic
1012830990 6:104203212-104203234 ACCTGACAAAACAAACAATGGGG + Intergenic
1013335047 6:109149384-109149406 ACCTGAAAAAACAAGCAACGGGG - Intronic
1013390750 6:109684124-109684146 ACCTGACACAAAAAGCAATGGGG + Intronic
1013402091 6:109807872-109807894 ATCTGACAAAACAAGCAATGGGG - Intronic
1013934219 6:115573360-115573382 ATCTGAAAAAATTAGCAATCCGG - Intergenic
1014533337 6:122587006-122587028 AACAAACTAAATAAGCAATGTGG + Intronic
1014872175 6:126610265-126610287 ACCTACAAAAACAAGCAATGGGG - Intergenic
1015000128 6:128204150-128204172 ACCTGAAAAAACAAGCAATGGGG + Intronic
1016226176 6:141741224-141741246 ATCTGACAAAAAAAGCAATGGGG + Intergenic
1016472720 6:144391369-144391391 AACTGACATAATAAGAACTGGGG - Intronic
1016612834 6:146011818-146011840 AGCTGACAAAAGAAGCAATGGGG - Intergenic
1017211970 6:151866991-151867013 ACCTGACAAAACAAGCAATGGGG + Intronic
1017662642 6:156688642-156688664 ATATAATAAAATAAGCAATGTGG + Intergenic
1018459441 6:163983840-163983862 ACCAGACAACATGATCAATGCGG - Intergenic
1018491432 6:164297815-164297837 CCATGACAAAAGCAGCAATGGGG - Intergenic
1019098298 6:169605833-169605855 AGCTGACAAAATCAACAATGGGG + Intronic
1019169606 6:170125404-170125426 ACCTGTGCAAATAAGAAATGAGG + Intergenic
1020614940 7:10447481-10447503 ACCTGACAAAACAAGCAGTGGGG + Intergenic
1020690503 7:11348978-11349000 ACCTGACAAAAACAGCAATAGGG - Intergenic
1020744185 7:12060542-12060564 AGCTAACATCATAAGCAATGGGG + Intergenic
1020757851 7:12226137-12226159 ACCTGACAAAAACAAGAATGGGG - Intronic
1021252607 7:18349700-18349722 TCCTGACAAAAAAAAAAATGTGG + Intronic
1021870125 7:24997531-24997553 ACCTGACAAAACAAGCAATGGGG - Intergenic
1021943444 7:25702516-25702538 ACCTGACAAAAACAGAAATGGGG + Intergenic
1022676128 7:32500871-32500893 ACCTGACAAAATAAGCAATGGGG - Intronic
1022885334 7:34637729-34637751 ACCTGACAAAACAAGCAATGAGG + Intergenic
1023064233 7:36360329-36360351 ACCTGTCAAAATACTCAAGGAGG + Intronic
1023421341 7:39983284-39983306 TACTGAAAAAACAAGCAATGGGG - Intronic
1023697262 7:42860401-42860423 ACCTGACAAAAACAGCAATGGGG - Intergenic
1024040906 7:45553085-45553107 AATTGACAAAACAAGCAGTGGGG + Intergenic
1024424191 7:49206908-49206930 ACCACACAACCTAAGCAATGAGG + Intergenic
1024664425 7:51531816-51531838 ACCTGACAAAAACAACAATGGGG - Intergenic
1025727222 7:64077479-64077501 ACCTGTCAATATAATAAATGTGG + Intronic
1025784186 7:64629185-64629207 ACCTAAAAAAACAAGCAATGGGG + Intergenic
1026351822 7:69523640-69523662 ACATGACAAAAGAAGCAAATGGG - Intergenic
1027869160 7:83684871-83684893 AACTGAAATAATAAGAAATGGGG + Intergenic
1027949473 7:84796016-84796038 AATTGACAAAACAAGCAATGGGG - Intergenic
1028080732 7:86572054-86572076 ACCTGAAAAAATAAGCAATAGGG + Intergenic
1028319649 7:89443081-89443103 ACCTGACAAAAACAAGAATGGGG + Intergenic
1028767200 7:94572994-94573016 AGCTGACAAAACATGCAATGGGG - Intergenic
1029035807 7:97520135-97520157 ACCTTACAAATTAAGAAATTGGG - Intergenic
1030390820 7:108926295-108926317 ATCTGACAAAACAAGCAATGGGG - Intergenic
1030732237 7:113004003-113004025 ACTTGACAGAATGAGCCATGAGG + Intergenic
1030806545 7:113927152-113927174 AGCAGACAAAACAAGCAAGGGGG - Intronic
1030945947 7:115720490-115720512 ACTAGACAAAATAAAAAATGAGG - Intergenic
1031179132 7:118392850-118392872 ACCTGACAAAACAAGCAATGGGG + Intergenic
1031270684 7:119645351-119645373 ACGTGACAAAATAAGAAATGGGG - Intergenic
1031523582 7:122796590-122796612 ACCTGACAAAACAAGCTAGGAGG + Intronic
1031775409 7:125902681-125902703 ACCTGACATAATAAGCGTTTTGG + Intergenic
1033155581 7:138954432-138954454 AACTGCCAAACTAAGCAGTGTGG + Intronic
1033565351 7:142573248-142573270 ACCTGACAAAACAAGCAATGGGG + Intergenic
1033873068 7:145781181-145781203 ACCTGAGAAAATAAGCAACGGGG - Intergenic
1033931598 7:146530106-146530128 GTCTTCCAAAATAAGCAATGGGG + Intronic
1033957408 7:146868282-146868304 AGATGACAAAACAAGCAATGAGG - Intronic
1033988080 7:147250794-147250816 GACTTACAAAATCAGCAATGAGG + Intronic
1035113130 7:156501136-156501158 ACCTGACAAAATAAGCAATGGGG - Intergenic
1035558368 8:585041-585063 ACCTGAAAAAACAAGCAATGGGG - Intergenic
1036109593 8:5883235-5883257 ACCTGACAAAACAAGCACTGGGG - Intergenic
1036113957 8:5937501-5937523 ACCTGACAAAACAAGCAATGGGG + Intergenic
1037242607 8:16794382-16794404 GCCTGACAAAATACGCAATTAGG + Intergenic
1038095704 8:24307421-24307443 AGCTGAAATATTAAGCAATGTGG - Intronic
1038855494 8:31327382-31327404 ACCTGAGAAAAACAGCAATGGGG + Intergenic
1038897362 8:31800184-31800206 TCATAACAAAAAAAGCAATGAGG + Intronic
1039828379 8:41193910-41193932 ACCTGACAAACTGAAAAATGTGG - Intergenic
1040608115 8:48955166-48955188 ACCTGACAAAACAAGAAATGGGG - Intergenic
1040860343 8:51992438-51992460 ACCTGAAAAAACGAACAATGGGG + Intergenic
1041412214 8:57569181-57569203 ACCTGACAAAAAAAGAAATCGGG + Intergenic
1041837999 8:62238779-62238801 ACCTGACAAAACAAGCAACGGGG - Intergenic
1042888009 8:73573628-73573650 ACCTGCCAAAAACAGAAATGGGG + Intronic
1043038123 8:75224496-75224518 ACCTGAAGAAATAAGCAGTGGGG + Intergenic
1043272809 8:78355375-78355397 ACCTGAGAAAACAAGCAATGGGG + Intergenic
1043452832 8:80385250-80385272 ACCTGAGAAAACAAGCAATGGGG - Intergenic
1043564777 8:81535681-81535703 ACTTGAGAAAATATGCAATGAGG - Intergenic
1043730810 8:83678070-83678092 ATATGACAAAACAAGCAATGGGG + Intergenic
1044272271 8:90260210-90260232 AAATGACAAAACAAGCAATGGGG + Intergenic
1044349965 8:91152393-91152415 ACCTGACAAAACAAGCAATGGGG - Intronic
1044384558 8:91572152-91572174 ACCTGACAAAAACAACAATAGGG + Intergenic
1044596599 8:93965091-93965113 ACCTGACAAAAACAAAAATGGGG - Intergenic
1044825428 8:96191775-96191797 ACCTGACAAAATAAGCAATGGGG - Intergenic
1044835489 8:96291666-96291688 ACCCTATAGAATAAGCAATGTGG - Intronic
1045389186 8:101698657-101698679 ACCTCACAAAACAAGTAATGGGG + Intronic
1045593932 8:103631395-103631417 ACGTACAAAAATAAGCAATGTGG - Intronic
1045610033 8:103828831-103828853 AGTTGACAAAGAAAGCAATGGGG - Intronic
1046285370 8:112086678-112086700 ACCTGACAAAAAAAGCAATGCGG + Intergenic
1047093838 8:121602418-121602440 ATCTGATAAAATAAGCACTTTGG - Intergenic
1047747979 8:127859524-127859546 ACCTCACATAAGAAGCTATGAGG + Intergenic
1048786214 8:138053198-138053220 ACCGGAAAAAACAAGCAATGGGG - Intergenic
1049438737 8:142599590-142599612 ACCTCACAAAATGAGCAGTCAGG + Intergenic
1051274211 9:15383471-15383493 ACTTGAGGAAATAAGCAAGGAGG + Intergenic
1051537094 9:18171944-18171966 ACGTGAAAAAACAAGAAATGGGG - Intergenic
1051962171 9:22780068-22780090 TGCTGACAAAACAAGCAATGGGG - Intergenic
1052047678 9:23813462-23813484 AGCTCACAACATCAGCAATGAGG + Intronic
1052749308 9:32473191-32473213 ACCTGAGAAAAAAAGCATTTTGG + Intronic
1052885474 9:33643562-33643584 ATGTGACAAGAAAAGCAATGGGG + Intergenic
1055540438 9:77299024-77299046 ACCTGAAAAAACAAGCAATGGGG - Intronic
1056158356 9:83862440-83862462 ACCTGACAAAACAAGAAATGGGG - Intronic
1058187167 9:101868698-101868720 CCCTGACTAAATTAGGAATGGGG + Intergenic
1058193537 9:101947031-101947053 AACTGAAAAAATAAGTAAAGCGG - Intergenic
1058327089 9:103711963-103711985 AGATGACAAAAAGAGCAATGGGG - Intergenic
1058549289 9:106096611-106096633 ACCTGACAAAACAAGCAATGGGG + Intergenic
1058916621 9:109573047-109573069 ACTTGACAAAACAAGCAACAAGG + Intergenic
1058926661 9:109671368-109671390 ACCTGACAAAACAAGCAATAAGG - Intronic
1059078689 9:111223648-111223670 ACCTGACAAAACAAGCAATGGGG - Intergenic
1059262274 9:112989387-112989409 ACCTGAAAAAACAAGCAATTGGG - Intergenic
1059543152 9:115150492-115150514 AACTGAAAAAATAGCCAATGTGG + Intronic
1059745763 9:117199387-117199409 AACTGACAAAAAAAGGAATGGGG - Intronic
1060474780 9:123978531-123978553 ACCTAACAAAGAAAGAAATGAGG - Intergenic
1060476582 9:123991592-123991614 ACCTAACAAAGAAAGAAATGAGG + Intergenic
1060543467 9:124447177-124447199 ACCTGACAAAGTAAGCGCTTTGG - Intergenic
1061585356 9:131563838-131563860 AACTGTGAAAATAAGCAATGAGG - Intergenic
1062188601 9:135232571-135232593 ACTTGACAAAGAAAGGAATGTGG + Intergenic
1185812433 X:3123157-3123179 ACCTGAAAAAACAAGCAATGGGG - Intergenic
1188350198 X:29120404-29120426 ATCAGCAAAAATAAGCAATGGGG - Intronic
1188645088 X:32555704-32555726 ACCTGAAAAAACAAGCAATGGGG + Intronic
1188771037 X:34154806-34154828 AGCAGACAAAACAAACAATGAGG - Intergenic
1188796787 X:34476801-34476823 AGCAGACAAAACAAGCAATGAGG - Intergenic
1188868731 X:35347667-35347689 AATTGATAAAATAAGCAATAGGG - Intergenic
1188930959 X:36110377-36110399 AATTGACAAAAAAAGCAATGGGG - Intronic
1189697841 X:43684052-43684074 AACAGACAAAAAAAGAAATGTGG + Intronic
1190880508 X:54488775-54488797 AGTTGACAAAAGAAGCAATAGGG + Intronic
1191073298 X:56425322-56425344 ACCTGACAAAAAAAGAAGTGGGG - Intergenic
1191099191 X:56706689-56706711 ACCTGACAAAACAAGCAATAGGG - Intergenic
1191573151 X:62658776-62658798 ACCTGAGAAAACAAGCAATGGGG - Intergenic
1191701729 X:64049142-64049164 ACCTGACAAAACAAGCAATGGGG + Intergenic
1191798158 X:65045618-65045640 ACCTGTCAAAATAATCCATGGGG + Intergenic
1191831939 X:65424731-65424753 ACCTGACAAAAAAAGCAATGGGG - Intronic
1192714112 X:73620964-73620986 ACCTGAAAAAATAAGCAATGGGG - Intronic
1192951353 X:76020577-76020599 ACCTGAAAAAACAAGAAATGGGG + Intergenic
1192957666 X:76090507-76090529 ACCTGACAAAACAAGCAATGGGG - Intergenic
1192964628 X:76164186-76164208 ATCTGACAAAACAAGCAACGGGG + Intergenic
1193018470 X:76762638-76762660 AGCTAACATAATAAGAAATGGGG + Intergenic
1193035102 X:76941371-76941393 ACTATACAAAAAAAGCAATGGGG + Intergenic
1193035322 X:76944252-76944274 ACAAAAAAAAATAAGCAATGGGG - Intergenic
1193160815 X:78227196-78227218 ACCTGCACAAACAAGCAATGGGG - Intergenic
1193199370 X:78670024-78670046 GCCTGACAAAACAAGCAATGGGG + Intergenic
1193252201 X:79304625-79304647 ACCAACCAAAACAAGCAATGAGG + Intergenic
1193318809 X:80096350-80096372 CCCTGACAAAAAAAGCAATGGGG + Intergenic
1193367775 X:80655443-80655465 ACCTGACAAAACAAGCAATGGGG + Intergenic
1193566920 X:83087994-83088016 GTCAGAAAAAATAAGCAATGGGG - Intergenic
1193634164 X:83927626-83927648 ACCTGACAAAAAAAGCAATGGGG - Intergenic
1193748896 X:85318634-85318656 ATCTACAAAAATAAGCAATGGGG - Intronic
1193756305 X:85413096-85413118 AACTGACAAATTCAGTAATGTGG - Intergenic
1193812491 X:86068134-86068156 ACATGATAAAACAAGCAATGGGG + Intergenic
1193848468 X:86504895-86504917 TCCTGTCAAAGTAAGGAATGGGG + Intronic
1194027872 X:88776448-88776470 ACCTGACAAAATAAGCAATGGGG - Intergenic
1194287228 X:92024894-92024916 ACCTGACAAAAATAGGAATTGGG + Intronic
1194551064 X:95300122-95300144 ACCTGACAAAACAAGCAATGGGG + Intergenic
1194918218 X:99730674-99730696 ACCTGACAAAAACAACAATGGGG + Intergenic
1195098458 X:101529209-101529231 ACCTGACAAAACAAGCAATGGGG + Intronic
1195140553 X:101955053-101955075 ACCTGACGAAAACAGCAATGGGG + Intergenic
1195382657 X:104285376-104285398 ACCTGTCAGATTAAGCAATTAGG + Intergenic
1195669675 X:107459119-107459141 ACCTGAAAGAGTGAGCAATGAGG + Intergenic
1195789999 X:108573792-108573814 ACCTGAAAATAAAAGCAATCTGG + Intronic
1196367320 X:114938227-114938249 ACCTGACAAAACAAGCAATGGGG - Intergenic
1196584477 X:117413893-117413915 AACTAACAAAAAAAGCAATGGGG + Intergenic
1196854020 X:119966075-119966097 ACCTGACAAAAAAAGAAACAGGG + Intergenic
1196855415 X:119978308-119978330 ACCTGACAAAAAAAGAAACGGGG - Intergenic
1197388690 X:125832959-125832981 AACGGACAAAAAATGCAATGGGG + Intergenic
1197512040 X:127381610-127381632 AGTTTACAAAACAAGCAATGTGG - Intergenic
1197532977 X:127653503-127653525 ATCTGACAAAAAAAGCAATGGGG + Intergenic
1197680583 X:129379951-129379973 AGTTGACAAAATAAGCAATGGGG + Intergenic
1198137433 X:133767996-133768018 ACCTGACAAAATAAGTCAGCTGG + Intronic
1199235071 X:145482862-145482884 TCCCTTCAAAATAAGCAATGAGG - Intergenic
1199254613 X:145704935-145704957 ACCTGACAAAACAAGAAATGGGG + Intergenic
1199300750 X:146211041-146211063 AGTTGACAAAACAAGCAACGAGG - Intergenic
1199387917 X:147244832-147244854 ACCTGACAAAAACAGCAATGGGG + Intergenic
1199469398 X:148177406-148177428 ACCTGAAAAAACAAGAAATGGGG - Intergenic
1199565315 X:149209486-149209508 ACCTGAAAAAGGAAGCCATGAGG + Intergenic
1199748067 X:150787940-150787962 AATTGACAAAACAAGCAGTGGGG - Intronic
1200370368 X:155718872-155718894 AAGTTATAAAATAAGCAATGAGG + Intergenic
1200390289 X:155938189-155938211 AGGAGACAAAAAAAGCAATGGGG - Intronic
1200604766 Y:5249462-5249484 ACCTGACAAAAATAGGAATTGGG + Intronic
1200885865 Y:8268960-8268982 ACCTGACAAAACAAGCAATGGGG + Intergenic
1201596328 Y:15673653-15673675 ACCTGAGAAAAACAGAAATGGGG - Intergenic
1201599989 Y:15717868-15717890 ACCAGACAAAACAAGAATTGGGG + Intergenic
1201664900 Y:16439844-16439866 ACCAGAGAAAATTAGCAGTGAGG - Intergenic
1201946740 Y:19518750-19518772 ATCTTACAAAAAAAGCAATGGGG + Intergenic
1202065389 Y:20934232-20934254 ACTTGACAAAAACATCAATGGGG + Intergenic
1202079338 Y:21068476-21068498 ACCTGAGAAAAACAGCAATGGGG + Intergenic
1202084783 Y:21124790-21124812 ACCTGACAAAATAAGAAATGGGG - Intergenic
1202190598 Y:22239783-22239805 ACCTTACAAGCAAAGCAATGTGG - Intergenic