ID: 1035113749

View in Genome Browser
Species Human (GRCh38)
Location 7:156505911-156505933
Sequence TGGGACCTCCTTTCTGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035113749_1035113761 6 Left 1035113749 7:156505911-156505933 CCGGCCACAGAAAGGAGGTCCCA No data
Right 1035113761 7:156505940-156505962 TCTGGGGGCACGAAGAATCAGGG No data
1035113749_1035113757 -9 Left 1035113749 7:156505911-156505933 CCGGCCACAGAAAGGAGGTCCCA No data
Right 1035113757 7:156505925-156505947 GAGGTCCCAGGGGAGTCTGGGGG No data
1035113749_1035113764 15 Left 1035113749 7:156505911-156505933 CCGGCCACAGAAAGGAGGTCCCA No data
Right 1035113764 7:156505949-156505971 ACGAAGAATCAGGGGAGTCCGGG No data
1035113749_1035113760 5 Left 1035113749 7:156505911-156505933 CCGGCCACAGAAAGGAGGTCCCA No data
Right 1035113760 7:156505939-156505961 GTCTGGGGGCACGAAGAATCAGG No data
1035113749_1035113765 16 Left 1035113749 7:156505911-156505933 CCGGCCACAGAAAGGAGGTCCCA No data
Right 1035113765 7:156505950-156505972 CGAAGAATCAGGGGAGTCCGGGG No data
1035113749_1035113756 -10 Left 1035113749 7:156505911-156505933 CCGGCCACAGAAAGGAGGTCCCA No data
Right 1035113756 7:156505924-156505946 GGAGGTCCCAGGGGAGTCTGGGG No data
1035113749_1035113763 14 Left 1035113749 7:156505911-156505933 CCGGCCACAGAAAGGAGGTCCCA No data
Right 1035113763 7:156505948-156505970 CACGAAGAATCAGGGGAGTCCGG No data
1035113749_1035113762 7 Left 1035113749 7:156505911-156505933 CCGGCCACAGAAAGGAGGTCCCA No data
Right 1035113762 7:156505941-156505963 CTGGGGGCACGAAGAATCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035113749 Original CRISPR TGGGACCTCCTTTCTGTGGC CGG (reversed) Intergenic
No off target data available for this crispr