ID: 1035113752

View in Genome Browser
Species Human (GRCh38)
Location 7:156505915-156505937
Sequence CCCCTGGGACCTCCTTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035113752_1035113760 1 Left 1035113752 7:156505915-156505937 CCACAGAAAGGAGGTCCCAGGGG No data
Right 1035113760 7:156505939-156505961 GTCTGGGGGCACGAAGAATCAGG No data
1035113752_1035113763 10 Left 1035113752 7:156505915-156505937 CCACAGAAAGGAGGTCCCAGGGG No data
Right 1035113763 7:156505948-156505970 CACGAAGAATCAGGGGAGTCCGG No data
1035113752_1035113764 11 Left 1035113752 7:156505915-156505937 CCACAGAAAGGAGGTCCCAGGGG No data
Right 1035113764 7:156505949-156505971 ACGAAGAATCAGGGGAGTCCGGG No data
1035113752_1035113761 2 Left 1035113752 7:156505915-156505937 CCACAGAAAGGAGGTCCCAGGGG No data
Right 1035113761 7:156505940-156505962 TCTGGGGGCACGAAGAATCAGGG No data
1035113752_1035113762 3 Left 1035113752 7:156505915-156505937 CCACAGAAAGGAGGTCCCAGGGG No data
Right 1035113762 7:156505941-156505963 CTGGGGGCACGAAGAATCAGGGG No data
1035113752_1035113765 12 Left 1035113752 7:156505915-156505937 CCACAGAAAGGAGGTCCCAGGGG No data
Right 1035113765 7:156505950-156505972 CGAAGAATCAGGGGAGTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035113752 Original CRISPR CCCCTGGGACCTCCTTTCTG TGG (reversed) Intergenic
No off target data available for this crispr