ID: 1035113761

View in Genome Browser
Species Human (GRCh38)
Location 7:156505940-156505962
Sequence TCTGGGGGCACGAAGAATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035113748_1035113761 7 Left 1035113748 7:156505910-156505932 CCCGGCCACAGAAAGGAGGTCCC No data
Right 1035113761 7:156505940-156505962 TCTGGGGGCACGAAGAATCAGGG No data
1035113749_1035113761 6 Left 1035113749 7:156505911-156505933 CCGGCCACAGAAAGGAGGTCCCA No data
Right 1035113761 7:156505940-156505962 TCTGGGGGCACGAAGAATCAGGG No data
1035113752_1035113761 2 Left 1035113752 7:156505915-156505937 CCACAGAAAGGAGGTCCCAGGGG No data
Right 1035113761 7:156505940-156505962 TCTGGGGGCACGAAGAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035113761 Original CRISPR TCTGGGGGCACGAAGAATCA GGG Intergenic
No off target data available for this crispr