ID: 1035115943

View in Genome Browser
Species Human (GRCh38)
Location 7:156524006-156524028
Sequence TCACACTCCCAAGCCCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035115939_1035115943 1 Left 1035115939 7:156523982-156524004 CCTTGGTGGAAGGTGTCTACCGG No data
Right 1035115943 7:156524006-156524028 TCACACTCCCAAGCCCAAACAGG No data
1035115938_1035115943 2 Left 1035115938 7:156523981-156524003 CCCTTGGTGGAAGGTGTCTACCG No data
Right 1035115943 7:156524006-156524028 TCACACTCCCAAGCCCAAACAGG No data
1035115933_1035115943 25 Left 1035115933 7:156523958-156523980 CCATCGGGAACACAGGGCAACCT No data
Right 1035115943 7:156524006-156524028 TCACACTCCCAAGCCCAAACAGG No data
1035115937_1035115943 5 Left 1035115937 7:156523978-156524000 CCTCCCTTGGTGGAAGGTGTCTA No data
Right 1035115943 7:156524006-156524028 TCACACTCCCAAGCCCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035115943 Original CRISPR TCACACTCCCAAGCCCAAAC AGG Intergenic
No off target data available for this crispr