ID: 1035117083

View in Genome Browser
Species Human (GRCh38)
Location 7:156533649-156533671
Sequence CAGGGAGGGCCGTTCGCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035117083_1035117091 9 Left 1035117083 7:156533649-156533671 CCTCATGCGAACGGCCCTCCCTG No data
Right 1035117091 7:156533681-156533703 CACTTTGTCCCCTCCATGCCAGG No data
1035117083_1035117097 21 Left 1035117083 7:156533649-156533671 CCTCATGCGAACGGCCCTCCCTG No data
Right 1035117097 7:156533693-156533715 TCCATGCCAGGCCAGCCCTGGGG No data
1035117083_1035117095 19 Left 1035117083 7:156533649-156533671 CCTCATGCGAACGGCCCTCCCTG No data
Right 1035117095 7:156533691-156533713 CCTCCATGCCAGGCCAGCCCTGG No data
1035117083_1035117096 20 Left 1035117083 7:156533649-156533671 CCTCATGCGAACGGCCCTCCCTG No data
Right 1035117096 7:156533692-156533714 CTCCATGCCAGGCCAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035117083 Original CRISPR CAGGGAGGGCCGTTCGCATG AGG (reversed) Intergenic
No off target data available for this crispr