ID: 1035117159

View in Genome Browser
Species Human (GRCh38)
Location 7:156534163-156534185
Sequence CAGTGCCGGGAGTGGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035117159_1035117169 -5 Left 1035117159 7:156534163-156534185 CCACCATCCCACTCCCGGCACTG No data
Right 1035117169 7:156534181-156534203 CACTGGGCCAGGGCCCAAACAGG No data
1035117159_1035117174 17 Left 1035117159 7:156534163-156534185 CCACCATCCCACTCCCGGCACTG No data
Right 1035117174 7:156534203-156534225 GAACCCTCAGCCAAGAGGCTTGG No data
1035117159_1035117173 12 Left 1035117159 7:156534163-156534185 CCACCATCCCACTCCCGGCACTG No data
Right 1035117173 7:156534198-156534220 AACAGGAACCCTCAGCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035117159 Original CRISPR CAGTGCCGGGAGTGGGATGG TGG (reversed) Intergenic
No off target data available for this crispr