ID: 1035120961

View in Genome Browser
Species Human (GRCh38)
Location 7:156566575-156566597
Sequence ATTCTAATCTCTGCCTCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035120961_1035120963 23 Left 1035120961 7:156566575-156566597 CCCTTGGAGGCAGAGATTAGAAT No data
Right 1035120963 7:156566621-156566643 TTTTCCCAAGTTCAAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035120961 Original CRISPR ATTCTAATCTCTGCCTCCAA GGG (reversed) Intergenic
No off target data available for this crispr