ID: 1035121628

View in Genome Browser
Species Human (GRCh38)
Location 7:156573163-156573185
Sequence CTGCGGCAATGGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035121621_1035121628 -5 Left 1035121621 7:156573145-156573167 CCAGGTTATCTACGGTTCCTGCG No data
Right 1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035121628 Original CRISPR CTGCGGCAATGGAGGGCAGA GGG Intergenic
No off target data available for this crispr