ID: 1035122300

View in Genome Browser
Species Human (GRCh38)
Location 7:156578870-156578892
Sequence GCTTCTGTGCTGAAGGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035122294_1035122300 0 Left 1035122294 7:156578847-156578869 CCTAAAACAGCGCTGGACCCTTC No data
Right 1035122300 7:156578870-156578892 GCTTCTGTGCTGAAGGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035122300 Original CRISPR GCTTCTGTGCTGAAGGGGCA CGG Intergenic
No off target data available for this crispr