ID: 1035123456

View in Genome Browser
Species Human (GRCh38)
Location 7:156589482-156589504
Sequence TTCCATCAAGTCCTATGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035123456_1035123457 10 Left 1035123456 7:156589482-156589504 CCATTACATAGGACTTGATGGAA No data
Right 1035123457 7:156589515-156589537 ATCCAATTTCGAACAGATCCAGG No data
1035123456_1035123459 17 Left 1035123456 7:156589482-156589504 CCATTACATAGGACTTGATGGAA No data
Right 1035123459 7:156589522-156589544 TTCGAACAGATCCAGGCACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035123456 Original CRISPR TTCCATCAAGTCCTATGTAA TGG (reversed) Intergenic
No off target data available for this crispr