ID: 1035124912

View in Genome Browser
Species Human (GRCh38)
Location 7:156601545-156601567
Sequence TCCATGAATATGCCCACACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035124905_1035124912 5 Left 1035124905 7:156601517-156601539 CCTCATTTCGTACTCATAACCGC No data
Right 1035124912 7:156601545-156601567 TCCATGAATATGCCCACACTAGG No data
1035124904_1035124912 15 Left 1035124904 7:156601507-156601529 CCTACTGTTACCTCATTTCGTAC No data
Right 1035124912 7:156601545-156601567 TCCATGAATATGCCCACACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035124912 Original CRISPR TCCATGAATATGCCCACACT AGG Intergenic
No off target data available for this crispr