ID: 1035129625

View in Genome Browser
Species Human (GRCh38)
Location 7:156640323-156640345
Sequence CCGCCCGCCCACCTGGGCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 348}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035129625_1035129638 20 Left 1035129625 7:156640323-156640345 CCCAGGCCCAGGTGGGCGGGCGG 0: 1
1: 0
2: 3
3: 39
4: 348
Right 1035129638 7:156640366-156640388 CACAAAGCCGCCGGGGGCTGCGG 0: 1
1: 0
2: 2
3: 21
4: 228
1035129625_1035129631 -10 Left 1035129625 7:156640323-156640345 CCCAGGCCCAGGTGGGCGGGCGG 0: 1
1: 0
2: 3
3: 39
4: 348
Right 1035129631 7:156640336-156640358 GGGCGGGCGGCTGAGGAGCGTGG 0: 1
1: 0
2: 7
3: 70
4: 616
1035129625_1035129632 11 Left 1035129625 7:156640323-156640345 CCCAGGCCCAGGTGGGCGGGCGG 0: 1
1: 0
2: 3
3: 39
4: 348
Right 1035129632 7:156640357-156640379 GGCTGCGCCCACAAAGCCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 99
1035129625_1035129635 14 Left 1035129625 7:156640323-156640345 CCCAGGCCCAGGTGGGCGGGCGG 0: 1
1: 0
2: 3
3: 39
4: 348
Right 1035129635 7:156640360-156640382 TGCGCCCACAAAGCCGCCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 51
1035129625_1035129633 12 Left 1035129625 7:156640323-156640345 CCCAGGCCCAGGTGGGCGGGCGG 0: 1
1: 0
2: 3
3: 39
4: 348
Right 1035129633 7:156640358-156640380 GCTGCGCCCACAAAGCCGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 92
1035129625_1035129634 13 Left 1035129625 7:156640323-156640345 CCCAGGCCCAGGTGGGCGGGCGG 0: 1
1: 0
2: 3
3: 39
4: 348
Right 1035129634 7:156640359-156640381 CTGCGCCCACAAAGCCGCCGGGG 0: 1
1: 0
2: 0
3: 3
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035129625 Original CRISPR CCGCCCGCCCACCTGGGCCT GGG (reversed) Exonic
900178704 1:1302137-1302159 CCGCCCCTGCATCTGGGCCTGGG - Intronic
900229793 1:1550863-1550885 CCTCCCTCCCTGCTGGGCCTGGG + Intronic
900285895 1:1900146-1900168 CAGCCACCCCAGCTGGGCCTTGG + Intergenic
900299483 1:1969705-1969727 CAGCCTGCCCACCTGGGCGGGGG - Intronic
900512786 1:3068388-3068410 CCGCCCGCCGGCCTGGGCAGTGG + Intergenic
900544026 1:3218514-3218536 CCGCCCGCACAGGTGGGCATCGG + Intronic
900571724 1:3361931-3361953 CCACCTGCCCTCCTGGGCCGCGG - Intronic
900571733 1:3361964-3361986 CCACCTGCCCTCCTGGGCCACGG - Intronic
900571742 1:3361997-3362019 CCACCTGCCCTCCTGGGCCACGG - Intronic
900606488 1:3525861-3525883 CCCCTCGCCAAGCTGGGCCTCGG + Intronic
900974968 1:6011273-6011295 TCTCCCGCACACCTGGCCCTGGG - Intronic
900974989 1:6011351-6011373 CCTCCCGCACACCTGGCCCTGGG - Intronic
900975000 1:6011391-6011413 CCTCCCGCACACCTGGCCCTGGG - Intronic
900975020 1:6011470-6011492 CCTCCTGCACACCTGGCCCTGGG - Intronic
901373144 1:8817558-8817580 ACGCTCGCCCCGCTGGGCCTCGG - Intronic
901417753 1:9129161-9129183 TCCCCCGCCCATCTGGGCCCCGG + Exonic
901511931 1:9721868-9721890 CTGCCCGCCCCCCAGGGCCTTGG - Intronic
901659088 1:10787505-10787527 CCGCCCGCCCCCCTCGCCCCCGG - Intronic
901681317 1:10914454-10914476 CCCTCCTCCCACCTGTGCCTGGG - Intergenic
901872859 1:12148316-12148338 CAGCCAGGCCACCTGGGCATGGG - Intergenic
902169476 1:14598704-14598726 GCGCCCGCCCGCCGGGGTCTCGG + Exonic
902704015 1:18191988-18192010 CCTCCAGCCCTCCTGGGCCGGGG + Intronic
902876563 1:19344022-19344044 CCACCCTCCAGCCTGGGCCTAGG - Intronic
903271139 1:22189115-22189137 CTGTGCGCCCACCTTGGCCTGGG + Intergenic
903474971 1:23613358-23613380 CCCCCGCCCCACCTGGGCCAGGG + Intronic
903730221 1:25488288-25488310 CAGTCCTCCCACCTTGGCCTTGG + Intronic
903735545 1:25528105-25528127 CTGCCTGCCCGCCAGGGCCTGGG - Intergenic
903777153 1:25800388-25800410 CCGCGCGGCCGCCTGGGCCTCGG - Exonic
904032993 1:27544755-27544777 CCGTCCCACCACCTTGGCCTGGG + Intronic
905272465 1:36795950-36795972 CCCCCAGCCCACCTCTGCCTGGG - Exonic
906210634 1:44010663-44010685 GAGCCCACCCACCAGGGCCTGGG - Intronic
907278001 1:53327606-53327628 CCCCCCGCCCCCGCGGGCCTCGG - Intronic
911647466 1:100352231-100352253 CCGCCCGCTCCCCTGGGCCGAGG + Intronic
914504959 1:148281026-148281048 CCCCTCGCTCACCTCGGCCTCGG + Intergenic
914507605 1:148303122-148303144 CCCCTCGCTCACCTCGGCCTCGG - Intergenic
919755417 1:201063069-201063091 GAGCCCCCCTACCTGGGCCTTGG - Intronic
919812492 1:201417859-201417881 GCCCCTGCCCAGCTGGGCCTTGG + Intronic
922019314 1:221687886-221687908 CAGCCAGCCCACTTGGGCTTAGG - Intergenic
922339964 1:224647444-224647466 CCACCCCCCTGCCTGGGCCTGGG + Intronic
924087049 1:240463408-240463430 CCTCTCACCCACCTGGGCCTTGG - Intronic
924799414 1:247316735-247316757 CTGTCCACCCACCTGGCCCTTGG - Intronic
1063472024 10:6295671-6295693 CCCCCAGGCCAGCTGGGCCTTGG + Intergenic
1067040562 10:42951248-42951270 CAGCCCCTTCACCTGGGCCTCGG - Intergenic
1069258754 10:66367037-66367059 CAGCCCACACACCCGGGCCTGGG + Intronic
1070545875 10:77452120-77452142 CCGCCCTCCCACCTGGCCTCTGG + Intronic
1072731551 10:97850139-97850161 CCCCCGGCCCACCTGAGCCCGGG + Intergenic
1072782100 10:98258120-98258142 GCCCTCGCCCACCTGGGCCCCGG + Exonic
1073452296 10:103617144-103617166 CCTCTCGCCCACCTGGGCCCTGG - Intronic
1073848681 10:107588799-107588821 CCACCCCCCCACCTTGGCCAAGG - Intergenic
1074035430 10:109733656-109733678 CTGACCACCCACCTGGGCCAGGG + Intergenic
1075085017 10:119409122-119409144 CTGACCCCCAACCTGGGCCTCGG + Intronic
1075316485 10:121457639-121457661 CAGCTTTCCCACCTGGGCCTTGG - Intergenic
1075417026 10:122271697-122271719 CTGCCCGCCCACAGGGACCTTGG + Intronic
1075748361 10:124743686-124743708 GCGCCCGCCCGCCCTGGCCTGGG + Intronic
1075777546 10:124998239-124998261 CAGCCCGCCCTCCTGAGACTCGG + Intronic
1076613015 10:131738056-131738078 CGGCCAGCCTACCTGGTCCTCGG - Intergenic
1076748566 10:132527987-132528009 CCCCCCGCCCCCCGGGGCCATGG + Intergenic
1076810648 10:132884766-132884788 CCACCCGCCCATCGGGGCCCTGG + Intronic
1077008268 11:369258-369280 GCGCGCGTCCACCTGGGCCACGG - Intergenic
1077020887 11:416764-416786 CCCCGCGCCCACCTGCGCCCTGG + Intronic
1077047448 11:552716-552738 CCGCCTGCCCCCCAGTGCCTGGG + Intronic
1077053158 11:576712-576734 CCGCCCGCCCTCCCGGCCCGCGG - Intronic
1077277176 11:1717959-1717981 CCCGCCGCCCCCCTGGGGCTTGG - Intergenic
1077287203 11:1772957-1772979 CCCCTCCCCCACCTGTGCCTGGG - Intergenic
1077309530 11:1882243-1882265 CCACCCGCCCTGCAGGGCCTGGG + Intronic
1077371196 11:2182392-2182414 CCTCCCTCCCGCCAGGGCCTCGG + Intergenic
1077374056 11:2197412-2197434 CAGCCCGGCCACCTGGACATGGG - Intergenic
1077418464 11:2436904-2436926 CCGCTCGCCCACCTGGGCACTGG + Intergenic
1077506906 11:2933798-2933820 GCCTCCGCCCACCTGAGCCTGGG + Intergenic
1078552287 11:12289030-12289052 CGGCCCTCCCACCTGGGGCTTGG - Intronic
1083315271 11:61811058-61811080 CAGCCAGCCAGCCTGGGCCTAGG + Exonic
1084450298 11:69232868-69232890 CCATCCTCCCACCTGGGTCTGGG - Intergenic
1084753890 11:71222519-71222541 GCGTCCGGCCAGCTGGGCCTCGG - Intronic
1084938850 11:72601567-72601589 CCCACCGCCCACCTCGGCCCAGG - Intronic
1085423149 11:76380892-76380914 CCGCCCGCCCGTCGGGGCCGGGG + Exonic
1090003159 11:122979249-122979271 CCTCCCGCCCACCTGCGTCTCGG + Exonic
1091282072 11:134387506-134387528 CTGCCTGCCCAGCTGGGCCTTGG - Intronic
1091795496 12:3295438-3295460 CCTCCTGCCCACCAGGGCCTGGG - Intergenic
1092194875 12:6543135-6543157 CCGCCCACCACTCTGGGCCTTGG + Intronic
1095951403 12:47783804-47783826 CTGCCCGCCCACCATGCCCTTGG - Exonic
1100985537 12:100199334-100199356 CCTCCCCTCCACCTGGGCTTAGG - Intronic
1102052376 12:109872081-109872103 GCACCCGCCCACCCGGTCCTGGG - Intronic
1102375130 12:112415993-112416015 CTGCACTCCCACCTGGGCGTCGG - Intronic
1104289506 12:127455392-127455414 CCCCCCGCCCCGCAGGGCCTCGG + Intergenic
1104924429 12:132306462-132306484 CTGCCCGCCCACCTGGACCTCGG - Intronic
1104975858 12:132551720-132551742 CCGCCCCCTCCCCTGGCCCTTGG + Intronic
1105973930 13:25456480-25456502 CTGTCTGCCCACCTGTGCCTTGG + Intronic
1108228582 13:48316251-48316273 CCCACCGCCCCCCTGGTCCTTGG - Intronic
1109284876 13:60397638-60397660 CCGCCCGCCGCCCGGGGCCCAGG - Intronic
1112344357 13:98577311-98577333 CCGCCCGCCCGCGGGGGCGTGGG - Intronic
1112369562 13:98782800-98782822 CTGCCCACCCACGTGAGCCTTGG - Intergenic
1113274924 13:108718284-108718306 CTGCCCACCCACCTGGACATTGG + Intronic
1113575164 13:111390215-111390237 CCCACCGTCCACCTGGGCCGAGG + Intergenic
1113902257 13:113803830-113803852 CTGCCCGCACCCCTGGGGCTGGG - Intronic
1114473778 14:22980864-22980886 CCGCGCCCCCACCCGGGCCCAGG - Intronic
1114552745 14:23542971-23542993 TGACCCGCCCACCTTGGCCTGGG + Intronic
1115906760 14:38209893-38209915 CCGCCGGCCCACCGTGGCCAAGG + Exonic
1121324214 14:93010490-93010512 CTGCTGGCCCACCTGGGCCTCGG - Intronic
1121355101 14:93207431-93207453 CCGCGCGCCCACCTGAGAGTAGG - Exonic
1121618690 14:95331560-95331582 CTCCCCTCCCACCTGCGCCTGGG + Intergenic
1121637852 14:95465919-95465941 CCTCACCCTCACCTGGGCCTTGG + Exonic
1122632477 14:103113236-103113258 CTGCCCTCCCAGTTGGGCCTGGG - Intergenic
1122824559 14:104363270-104363292 CCTCCAGCACACCTGGGTCTGGG + Intergenic
1122929728 14:104927747-104927769 CCGTCCTCCCACCTGGGGCCAGG + Exonic
1123017766 14:105383522-105383544 CACGCCGTCCACCTGGGCCTGGG + Intronic
1123036916 14:105475286-105475308 CCGCGCGCTCCCGTGGGCCTGGG + Intronic
1123044652 14:105505382-105505404 CCGCCTGCCCACCTGGCCCCCGG - Intergenic
1124023786 15:25946242-25946264 CCTCCTGCCCACCTGGAGCTTGG - Intergenic
1124347424 15:28931974-28931996 CAGCCCTCCCAACTGGGTCTGGG + Intronic
1125410429 15:39400395-39400417 CCCCCTGCCCACCTGCTCCTTGG - Intergenic
1125433814 15:39625207-39625229 CAGCCCGGGCACCTGGGCCACGG - Intronic
1127267949 15:57376427-57376449 CCGCCCGCCCTCCTGGGAGGAGG - Intronic
1127995764 15:64152381-64152403 CCGCCCGCCTCACAGGGCCTGGG - Intronic
1128322659 15:66703883-66703905 CCGCGCGCCGACCTCCGCCTGGG + Exonic
1129667211 15:77586025-77586047 CCACGAGCCCACCGGGGCCTGGG - Intergenic
1129741584 15:77992188-77992210 CCTCCCTCCCCACTGGGCCTGGG + Intronic
1129880651 15:79004217-79004239 CTGCCTGCCCGCCTAGGCCTGGG + Intronic
1130257742 15:82333609-82333631 CCTCCCTCCCCACTGGGCCTGGG + Intergenic
1130597194 15:85256354-85256376 CCTCCCTCCCCACTGGGCCTGGG - Intergenic
1131387530 15:92019497-92019519 CCACCAGCTCTCCTGGGCCTAGG - Intronic
1132463863 16:68647-68669 CAGCCCCCCCAGCTGGTCCTGGG - Intronic
1132552679 16:559936-559958 CCGCCGGCCCACCCGAGCCAGGG - Intergenic
1132561290 16:595418-595440 CCTCACGTCCACCTGGGCCTGGG + Intronic
1132629486 16:910309-910331 CCGCCCCCACACCAGGGCCCAGG + Intronic
1132728280 16:1348227-1348249 ACCCCCGCCCACCTGGGGCCGGG - Exonic
1132765077 16:1530477-1530499 CCAGCCCCACACCTGGGCCTCGG - Intronic
1132804821 16:1770582-1770604 AAGCCCGCCCACCTGGGCCCTGG + Exonic
1132895747 16:2228616-2228638 CTGCCCGCCCACGTGGCCCCCGG - Intronic
1132934126 16:2472441-2472463 GCGCCCGCCCACCTGGAGGTCGG - Exonic
1133100428 16:3476006-3476028 CTGCCTGCCCTCCTGGGCCTGGG + Intronic
1136240289 16:28939076-28939098 CCCCCTGCCCACCAGGCCCTAGG - Intronic
1136417898 16:30114522-30114544 CCGCCCTCCCCACGGGGCCTCGG - Exonic
1136460632 16:30407971-30407993 CCCCCCGCCCACCGTGGCCCTGG - Intronic
1136512553 16:30748290-30748312 CCGGCCGCCCAATTGGGGCTGGG - Exonic
1137547843 16:49416481-49416503 CCTCCTGCTCACCGGGGCCTCGG - Intergenic
1138269242 16:55682984-55683006 GAGCCAGCCCATCTGGGCCTCGG - Intronic
1138331318 16:56218127-56218149 TCTCTCGCCCACCTGGGGCTAGG - Intronic
1139482271 16:67237054-67237076 CCCGCCGCCCACCAGCGCCTGGG + Exonic
1139483007 16:67241120-67241142 CCCCCCGCCCACCCCCGCCTGGG + Intronic
1139779537 16:69339424-69339446 CCGCTCGCGCCACTGGGCCTCGG + Exonic
1140402106 16:74679948-74679970 CCGCGAGACCACCTGAGCCTGGG - Intronic
1140469886 16:75208015-75208037 GCGCCAGCACACCTGGGCCCTGG + Intergenic
1140477610 16:75246824-75246846 CCTCCCGCACTGCTGGGCCTAGG + Intronic
1141621524 16:85238894-85238916 CCACCTGCACACCCGGGCCTGGG + Intergenic
1142249452 16:88984446-88984468 CCGCCCGCCCTCCAGAGCCAGGG + Intergenic
1142293259 16:89202097-89202119 CCGCCCGCCCTCCTCGGCGCTGG + Intergenic
1142608386 17:1094921-1094943 CAGCTCACCCACCTGGGCTTGGG - Intronic
1142839143 17:2613516-2613538 GCGCCTGGCCACCTGGGCCTGGG + Intronic
1144608684 17:16689896-16689918 CCGCCGGCGCACCTGCTCCTAGG - Intergenic
1144661200 17:17072094-17072116 ACGCACGCCCACCTGGTCCTGGG - Intronic
1145004188 17:19328283-19328305 CAGCCCTCCCACCTCGGCCCAGG - Intronic
1145128459 17:20320811-20320833 CCGCCGGCGCACCTGCTCCTAGG - Intergenic
1145242371 17:21247530-21247552 CCTTCCTCCCTCCTGGGCCTCGG - Intronic
1146912582 17:36658102-36658124 CCGCCCTCCCAGGCGGGCCTCGG - Intergenic
1147139590 17:38453789-38453811 CCGCCCGCCCCCCGGAGCCGCGG - Intronic
1147705369 17:42422034-42422056 CCGCGCCCCCACATCGGCCTCGG - Intronic
1147979946 17:44268197-44268219 CTGCCCGCCCCACTGGCCCTGGG + Intergenic
1148113741 17:45162455-45162477 CTGGCTGCCAACCTGGGCCTCGG + Intronic
1148122575 17:45221723-45221745 CAGCCCGCCCCCCTGGGGCTGGG + Intronic
1148156255 17:45426686-45426708 CTGCCCACCCACCTGAGCCTGGG + Intronic
1148534798 17:48430231-48430253 CCGCCCGCCCAGCCCGGCCGCGG + Intronic
1149528887 17:57379317-57379339 CCTCCCGCCCACCCTGGGCTGGG + Intronic
1150216926 17:63476457-63476479 CGGCCGGCACACCTGGGGCTTGG - Intergenic
1150387925 17:64775304-64775326 CTGCCCACCCACCTGAACCTGGG + Intergenic
1150488738 17:65560795-65560817 CCGCCCGGCCGCCTCGGCCTCGG + Intronic
1151440948 17:74128761-74128783 CTGCCCTCCCTCCTGGTCCTCGG - Intergenic
1151611912 17:75182254-75182276 CGGGCCGCCGTCCTGGGCCTGGG - Intergenic
1152089499 17:78238953-78238975 CTGCAGGACCACCTGGGCCTGGG + Intronic
1152377537 17:79926555-79926577 CCCCCTCCCCATCTGGGCCTGGG + Intergenic
1152660771 17:81540974-81540996 CAGGCCCCCCACCTGGCCCTGGG + Intronic
1154501079 18:14998342-14998364 CCGAGCGCGCACCAGGGCCTGGG - Intergenic
1156150335 18:34234056-34234078 CGGCCCGCCCCGCTGGTCCTGGG + Intergenic
1157338188 18:46756570-46756592 CCGCGCGCCCCCCGGGGCCCCGG - Exonic
1157464320 18:47930867-47930889 CCGCCTGCCACCCTGGGCCGCGG + Intronic
1158930950 18:62325061-62325083 CAGCCCGAGCACCTGGGCCAGGG + Intergenic
1160422559 18:78757155-78757177 GAACCCGCCCTCCTGGGCCTGGG + Intergenic
1160822871 19:1066581-1066603 CCCCACGTCCACCTGGTCCTGGG - Intronic
1160842774 19:1154015-1154037 CCACCCGCCCCCGTGGGCCCTGG - Intronic
1161022126 19:2015507-2015529 CCGCCCGCCCCGCCGGGCCCCGG - Exonic
1161038579 19:2098356-2098378 CAGCAAGCTCACCTGGGCCTGGG + Intronic
1161592225 19:5134051-5134073 CCGCCTGCCCACCTGGCAGTAGG - Exonic
1161608766 19:5229479-5229501 CCCCCCGCCCACCTGGGCATCGG + Exonic
1161713728 19:5864029-5864051 CCACCCTCCCACCTGGGCCTGGG + Intergenic
1161716176 19:5877292-5877314 CCACCCTTCTACCTGGGCCTGGG + Intronic
1161849481 19:6731170-6731192 CTCCCGTCCCACCTGGGCCTCGG + Intronic
1161960494 19:7520482-7520504 GCGGCCGCCGGCCTGGGCCTCGG + Exonic
1162445105 19:10718131-10718153 CTCCCCGCCCGCCCGGGCCTCGG - Exonic
1162567393 19:11451789-11451811 CCCCCCCCCCACCGAGGCCTAGG - Exonic
1162909850 19:13842839-13842861 CAGCCCGCCCGCCTGAGCCTCGG - Intergenic
1163243243 19:16076877-16076899 CCGTCCTCCTTCCTGGGCCTGGG + Intronic
1163677098 19:18660632-18660654 CCGCCTGCCCACCTCCGCCCAGG + Intronic
1163845961 19:19638147-19638169 CCGGGTGCCCACCTTGGCCTGGG + Exonic
1164810267 19:31149573-31149595 CCGCCCGCCCAAGTAGGTCTGGG + Intergenic
1165357682 19:35313743-35313765 CTGCCCCCACACCTGGCCCTGGG + Exonic
1166255201 19:41599372-41599394 CCGCCCCCACCCCTGGCCCTGGG + Intronic
1166787822 19:45379846-45379868 CCACCTGCCCAGCCGGGCCTGGG - Exonic
1167052054 19:47085306-47085328 GCCCCTGCCCACCTCGGCCTCGG + Exonic
1167504165 19:49862576-49862598 ACGCCCGGCCAACTGGGCCCCGG - Exonic
1168138049 19:54364770-54364792 CCCACCGCCCTCCTGGGCCTAGG - Exonic
925008809 2:467180-467202 CCTCCCTCCCACCTGGGCCCTGG + Intergenic
927215778 2:20667212-20667234 CCGCCCGCCCGCCCGGCCCACGG + Exonic
927905047 2:26849412-26849434 CCAGCCGGCCACCTGGGCCGCGG - Intronic
927965345 2:27264504-27264526 CCGCCCGCACACCTTGGCACGGG - Intronic
928149135 2:28810683-28810705 CCCCCCGCCCGCCCGAGCCTCGG - Intronic
929595125 2:43170831-43170853 ACACCCACCCACCTGGGGCTTGG + Intergenic
931881672 2:66576270-66576292 CCGCCCACGCACTGGGGCCTAGG - Intergenic
932305367 2:70698129-70698151 CCACCTGCCCACCTTTGCCTGGG - Intronic
932611442 2:73202961-73202983 CTGCCCGCCTACCTGAGCGTAGG + Exonic
934502529 2:94871553-94871575 CCTGCCGCCCACCAGGGCCAGGG - Exonic
934559199 2:95303589-95303611 TCCCCCGCTCTCCTGGGCCTGGG + Intronic
937221332 2:120344643-120344665 CCGGCCGCCCAGCTGGGCAAGGG + Intergenic
937419594 2:121742509-121742531 CCCCCTGCCCACCAGAGCCTGGG - Intronic
937993128 2:127675103-127675125 CCGCCCGCCAGCCCGGGCCGCGG + Intronic
938073505 2:128320170-128320192 CCGCCCGCTCAGCTGGGTTTGGG - Intergenic
938339140 2:130523812-130523834 CCACCAGCCCACCCAGGCCTGGG - Intronic
938350698 2:130596938-130596960 CCACCAGCCCACCCGGGCCTGGG + Intronic
938500247 2:131828531-131828553 CCGAGCGCGCACCAGGGCCTGGG - Intergenic
946019767 2:216633265-216633287 CCGCTCGCCCACCTCCGCGTTGG - Intronic
946301517 2:218827219-218827241 CCTTCCTCCCACCTGGGCCCAGG + Intronic
947534108 2:230930056-230930078 CCCGCCTCCCACCTGGGCCTTGG + Intronic
947566703 2:231198733-231198755 CCGCCCGCCGTCCTGGTGCTGGG + Intronic
948205999 2:236163289-236163311 CCGCCCTCCCTCCTGCTCCTCGG - Intergenic
949041031 2:241850089-241850111 CCGGGCTCCCACCAGGGCCTGGG - Exonic
949053913 2:241914327-241914349 CAGCATCCCCACCTGGGCCTGGG - Intergenic
1172028069 20:31962918-31962940 CCGCCCACCCATCTGTCCCTGGG - Intergenic
1172952633 20:38731591-38731613 CCGCCGGCGCACGTGGGTCTTGG - Intergenic
1173362985 20:42361042-42361064 CCACCCTGCCACCTTGGCCTTGG + Intronic
1173539821 20:43842946-43842968 CTGCCCTGCCACCTGGCCCTTGG + Intergenic
1174297692 20:49560845-49560867 CCGGACTCCCACCTTGGCCTTGG - Intronic
1174310080 20:49645944-49645966 CAACCCTCCCACCTAGGCCTGGG - Intronic
1174395554 20:50244680-50244702 CCTACCTCCCACCTGGGCCCAGG + Intergenic
1175253302 20:57622678-57622700 CCGCTCACCAACCTGGGCTTGGG + Intergenic
1175608449 20:60330462-60330484 CTGCCTGCCCACCTGGTGCTGGG + Intergenic
1175841774 20:62032530-62032552 CCGGTGGCCCACCAGGGCCTCGG + Intronic
1175877154 20:62235798-62235820 CCGCCAGCCCACCTGGTGCGGGG + Intronic
1175954733 20:62603518-62603540 CCACCTGCCCACCATGGCCTGGG + Intergenic
1176063807 20:63183821-63183843 CTGCAGGCCCACCTGGACCTTGG - Intergenic
1178722622 21:35023446-35023468 CCACCCACCCACCTGGGACAGGG - Intronic
1178865066 21:36320331-36320353 CCGCCCGCCCTCCTGGGACACGG - Intronic
1180078145 21:45473553-45473575 CTGCCCGCCCTCCCAGGCCTTGG + Intronic
1180158461 21:45988838-45988860 CGTCCCTCCCACCTGTGCCTGGG + Intronic
1180891346 22:19291457-19291479 CCGACCTCCCACCTGGGCTGGGG - Intronic
1180910584 22:19447366-19447388 CTCCCGGCGCACCTGGGCCTCGG + Exonic
1181023883 22:20116949-20116971 CCGCCTGGCCACCTCGTCCTGGG + Exonic
1181391726 22:22588061-22588083 CCCCACCCTCACCTGGGCCTGGG - Intergenic
1181415881 22:22758586-22758608 CCCCACCCTCACCTGGGCCTGGG - Intronic
1181428008 22:22856436-22856458 CCCCACCCTCACCTGGGCCTGGG - Intronic
1181513433 22:23398939-23398961 CAGCTCTCCTACCTGGGCCTGGG + Intergenic
1182424202 22:30263641-30263663 CCGGCCACCCCACTGGGCCTGGG + Exonic
1183366204 22:37408359-37408381 CCTCCCTCCCACCTGGTCATGGG + Intronic
1183420911 22:37710701-37710723 CCCACCACCCACCTGTGCCTAGG - Intronic
1183603065 22:38851145-38851167 CCGCAGGCCCACCTTGGGCTGGG + Intergenic
1183607111 22:38872271-38872293 GCTCCCGCCCGCCGGGGCCTGGG - Exonic
1183676968 22:39304620-39304642 TCGCCCTTCCACCTGTGCCTCGG - Intergenic
1183831137 22:40418889-40418911 CCGCCCGCCCCCCAGGGCTCAGG + Exonic
1184792394 22:46708075-46708097 CAGCCTGCACACCTGGCCCTTGG + Intronic
949258576 3:2079668-2079690 GCGACACCCCACCTGGGCCTCGG - Intergenic
950785026 3:15427406-15427428 CAGCCAGCCCCACTGGGCCTCGG + Exonic
954447761 3:50555722-50555744 ATGCCATCCCACCTGGGCCTGGG - Intergenic
954902538 3:54032113-54032135 GCCCCAGCCCCCCTGGGCCTAGG - Intergenic
956654618 3:71536963-71536985 CCTCCTGCCCACCTGAGCCATGG + Intronic
956813571 3:72888111-72888133 CCGCCCGCCCGCCGGGGACTGGG - Exonic
957290222 3:78269306-78269328 CCCCTCTCCCACCTTGGCCTGGG + Intergenic
957646756 3:82939915-82939937 CCGCCCGCCCAGGTGGGCAGTGG + Intergenic
957810078 3:85210644-85210666 CCATCCTCCCACCTGAGCCTCGG + Intronic
958026659 3:88058435-88058457 CCGCCCGAACCCCCGGGCCTGGG - Intronic
960285456 3:115823308-115823330 CTGCCCTCCTACCTGGGCCAGGG - Intronic
961451940 3:127006195-127006217 CCCTCCGCCCGCCTGGGCCTGGG + Intronic
961530307 3:127536449-127536471 CCCCCACCCCACCTGGACCTTGG - Intergenic
961754839 3:129121634-129121656 CCGACCGCCTGCCTCGGCCTCGG + Exonic
961855970 3:129871321-129871343 CCGCACTCCAAACTGGGCCTAGG + Intronic
962274664 3:134002960-134002982 CCATCTGCCCACCTGGGCATGGG + Intronic
963455350 3:145539585-145539607 CTTCCAGCCCACCTAGGCCTAGG + Intergenic
964414070 3:156429296-156429318 CCGCCCGCAGATCTAGGCCTGGG + Intronic
966734753 3:183179792-183179814 CAGCCCTCCCACCTGGGCCACGG + Intronic
967171616 3:186826896-186826918 CAGCCCTCCCACCTGGGCCACGG - Intergenic
967255851 3:187591223-187591245 CTGCCCCTCCCCCTGGGCCTTGG - Intergenic
968557166 4:1251441-1251463 CCACCCGCCTCCCTGTGCCTGGG + Intergenic
968597085 4:1491213-1491235 CCACACGGCCACCCGGGCCTCGG - Intergenic
968905766 4:3449896-3449918 CAGCCCGCCTGCCTGAGCCTGGG + Intergenic
969225993 4:5798668-5798690 CTGCCCCACCTCCTGGGCCTCGG - Exonic
969373708 4:6749714-6749736 CCGCACGGCCACCTTGGCTTTGG - Intergenic
969523816 4:7693985-7694007 CAGCCCACTCACCTGGGCCCCGG + Intronic
969609423 4:8218733-8218755 GCGCCAGCCCACCTCGGCCCAGG - Intronic
969697888 4:8745529-8745551 CCGCCTGTCCAGCTGGGGCTGGG - Intergenic
971907725 4:32748639-32748661 ACACACGCCCACCTGGGCTTTGG + Intergenic
973230750 4:47837152-47837174 CGGCCAGCCCTCCTGTGCCTAGG + Intronic
976146113 4:82044159-82044181 CCGCCCGCCAGCCGGGGCCGTGG + Intronic
978576950 4:110197771-110197793 CCGCCCGCCGCCCTTGGCCCTGG - Intronic
981093327 4:140755808-140755830 CCGCCCGGTCCCCTGGGGCTGGG - Intronic
984667840 4:182448263-182448285 CCGCGCTCGCCCCTGGGCCTCGG - Intronic
984999739 4:185471434-185471456 CCGCCCGCCCAGCGCGCCCTCGG - Intronic
985558774 5:571006-571028 CCTCCCGCACACCTGTGCCCAGG + Intergenic
985685072 5:1277642-1277664 CCCACCGCCCACCTGTGCCCGGG - Intronic
986666455 5:10108757-10108779 CAGCCAGCCCATCTGGGACTGGG - Intergenic
989812488 5:45695565-45695587 CCGCCCGCCCTCCTAGTCCCCGG + Intronic
998142928 5:139709981-139710003 CCGCCCGCCCTCCTAGGCTGAGG - Intergenic
998389758 5:141779898-141779920 CTGACAGCCCAGCTGGGCCTGGG - Intergenic
999272184 5:150302935-150302957 CCGCCCCTCCACCTGGGGCTCGG - Exonic
999282503 5:150374729-150374751 CCGCTTCCCCGCCTGGGCCTTGG - Exonic
1000082203 5:157858883-157858905 CCCCTCCCCCACGTGGGCCTCGG + Intronic
1001407042 5:171483736-171483758 CCGTCCGCTCTGCTGGGCCTGGG + Intergenic
1002009039 5:176261856-176261878 TCGCCAACCCATCTGGGCCTGGG - Intronic
1002217683 5:177650422-177650444 TCGCCAACCCATCTGGGCCTGGG + Intergenic
1002355705 5:178627225-178627247 CCCCCCGCCCACCCGGTCCCGGG + Intronic
1002497020 5:179622799-179622821 CCGCCCGTCCTCCTGGCCCTTGG - Intronic
1002530507 5:179841728-179841750 CCCACAGCCCACCTGGGCATTGG - Intronic
1002599546 5:180346465-180346487 CCCCCACCCCACCAGGGCCTCGG + Intronic
1002634916 5:180602536-180602558 CAGCCCGCACACCTGCGCCTGGG - Exonic
1002826324 6:777563-777585 CCTCCCGCCCCCGTGGGACTTGG + Intergenic
1003232810 6:4270077-4270099 CCGCCCACCCACCAGCTCCTAGG + Intergenic
1003869343 6:10389955-10389977 CCGCCCGCCTCCCTCGGCCCTGG - Intergenic
1004044452 6:12011788-12011810 GCGCCGGCCCAGCTGGGCCCCGG + Intronic
1007982139 6:46170685-46170707 CATCCCGCCCACCGAGGCCTGGG + Intronic
1012997984 6:105992647-105992669 CCGCGCGCAGAGCTGGGCCTGGG + Intergenic
1013273287 6:108561181-108561203 CCGCCCGCCCGCCCGCGGCTGGG - Exonic
1013479890 6:110544288-110544310 CTGCCCTCCCTCCTGTGCCTGGG - Intergenic
1013543022 6:111130666-111130688 CCCTCCCACCACCTGGGCCTTGG + Intronic
1016826449 6:148392785-148392807 ACTGCCGCCCACCTGGGCCAAGG - Intronic
1017080368 6:150662642-150662664 CTGACCGCCCACCTCAGCCTCGG + Intronic
1018808100 6:167276993-167277015 ACGCCCACCCTCCTGGGACTTGG + Intronic
1019313375 7:373596-373618 CCGACCGCCTATCCGGGCCTCGG + Intergenic
1019342353 7:514514-514536 CGGCCAGGCCACCTGGGCCTGGG - Intronic
1019365949 7:632884-632906 CCGTCAGCCCTCCTGAGCCTGGG + Intronic
1019631812 7:2053548-2053570 CCTGCCGCCCGCCAGGGCCTTGG - Intronic
1021958896 7:25852916-25852938 GCGCCCGCCGCCCTGTGCCTGGG + Intergenic
1022410369 7:30135088-30135110 CCGCCCGCCCTCCCGCTCCTAGG - Exonic
1024247268 7:47479876-47479898 CCCCCTGCCCACCTGAGCCTCGG - Intronic
1024247295 7:47479972-47479994 CCCCCTGCCCATCTGAGCCTTGG - Intronic
1026033720 7:66816260-66816282 CAGCCCTCCCCTCTGGGCCTCGG + Intergenic
1026471154 7:70694751-70694773 CCTCCCGCCGCCCGGGGCCTCGG + Intronic
1026970540 7:74465001-74465023 CCGCCCACCCACCTGGCTCCAGG + Intronic
1029238771 7:99143913-99143935 CCGCCCGGACGCCTGGGCCGCGG - Exonic
1029334096 7:99885848-99885870 CTGCCCTCCCACCTGGGGGTTGG + Intronic
1029414736 7:100435831-100435853 CCGCCCGCCCCCCTCACCCTCGG + Exonic
1029420084 7:100467770-100467792 CCCCCGCCCCACCGGGGCCTGGG - Intronic
1029732362 7:102446832-102446854 CTGGCCCCCCACCTGGCCCTGGG + Exonic
1030227526 7:107169366-107169388 CCGCGAGCTCACCTGGGCTTCGG + Intronic
1030260994 7:107563969-107563991 CCGCCCGCCCACCCAGCCCATGG + Exonic
1032082962 7:128869279-128869301 CCGCCCGCCCCACTGAGCCGCGG - Intronic
1032094517 7:128931304-128931326 CCGCTCCCTCCCCTGGGCCTGGG - Intergenic
1032279119 7:130486751-130486773 CCACCCGCCCTCCTGGGCGTGGG + Intronic
1034243247 7:149625092-149625114 CCCCTCGCCCAGCTGGGCCCCGG + Intergenic
1035129625 7:156640323-156640345 CCGCCCGCCCACCTGGGCCTGGG - Exonic
1035344610 7:158189960-158189982 CCCTCCGCACACCTGTGCCTCGG - Intronic
1035546555 8:486277-486299 CCACCTGCCCTCCTGGGCCAGGG - Intergenic
1036815778 8:11902047-11902069 CCATCCTCCCACCTGAGCCTCGG + Intergenic
1037811451 8:22089341-22089363 GCGCCCGCCCAGCCCGGCCTAGG - Intronic
1038481622 8:27905745-27905767 CTGCACTCCCGCCTGGGCCTGGG - Intronic
1039473781 8:37828922-37828944 CCGGGCGCCTTCCTGGGCCTGGG + Exonic
1042530497 8:69810113-69810135 CAGAACCCCCACCTGGGCCTGGG - Intronic
1043303358 8:78762487-78762509 CCGCCCGCCCGTCGGGGCCGGGG + Intronic
1043969631 8:86514842-86514864 GCGCTCGCGCACCTGGGGCTGGG + Intronic
1043969675 8:86515002-86515024 CCCCCCGCTCAACTGGGCATTGG - Intronic
1045098970 8:98825954-98825976 CCGCCCGCCAACCCAGGCCGCGG - Intronic
1047615421 8:126558539-126558561 CGCCCCGCCCACTCGGGCCTCGG + Intergenic
1049347215 8:142145440-142145462 CTGCCTGCCCACCTGTGCATTGG - Intergenic
1049396413 8:142403092-142403114 CCGCCGCCTCACCTGGGCCTCGG + Exonic
1049480517 8:142820348-142820370 CCTCCAGCCCTCATGGGCCTTGG + Intergenic
1049694079 8:143975192-143975214 CCGCCCGCTCAGCTGGGTCCAGG + Intronic
1049707810 8:144050927-144050949 CCGCCCCCCTACCAGGGCCCTGG + Intergenic
1049749357 8:144276070-144276092 CAGGACGCCCACGTGGGCCTCGG + Intronic
1049759217 8:144324361-144324383 CTGCCTGCCCTCCTGGGACTTGG - Intronic
1049776695 8:144409277-144409299 CCGGCCGCCCACCTGGCAGTTGG + Exonic
1053005319 9:34600445-34600467 CCGCCCCCACACCTGGACCCAGG + Intergenic
1053928656 9:43092984-43093006 GAGCCCACCCACCAGGGCCTTGG + Intergenic
1054835671 9:69672615-69672637 CCGCACGCCCACCGGCGCCGGGG - Intergenic
1057758092 9:97853128-97853150 CTGCCCGCCCCCCGGGGCCCGGG - Intergenic
1058663170 9:107283946-107283968 ACGCCCGCGGGCCTGGGCCTAGG + Intronic
1059443246 9:114322856-114322878 CCCCGCACCCACCTTGGCCTTGG + Intergenic
1059444438 9:114329627-114329649 CCCCGCACCCACCTTGGCCTTGG + Intergenic
1060140642 9:121206852-121206874 CCACCCTCCCACCTCAGCCTGGG + Intronic
1060700855 9:125747778-125747800 CCGGCCGCCCGCCCCGGCCTCGG + Intronic
1060935161 9:127510299-127510321 CCGCACGCACACCTCTGCCTTGG + Exonic
1061149812 9:128822294-128822316 CCCCCTGCCCACGTGTGCCTGGG + Exonic
1061693560 9:132354798-132354820 CCATCCGCCCACCGGGACCTAGG + Intronic
1061836598 9:133333706-133333728 CTGCCCGCCTACCTGGCCCCGGG + Exonic
1062153573 9:135033838-135033860 GCTCCCTCCCTCCTGGGCCTTGG - Intergenic
1062614704 9:137391095-137391117 CCCCCCTCCCAGCAGGGCCTCGG + Intronic
1185548768 X:967011-967033 GGGCCTGCCCACCTGGGCATCGG + Intergenic
1187154764 X:16712471-16712493 CCCACCGCCCACACGGGCCTCGG + Intronic
1188159634 X:26784013-26784035 CCGACTGCCCAACTGGGCATTGG - Intergenic
1190194771 X:48307510-48307532 CAGTCCTCCCACCTTGGCCTCGG + Intergenic
1190319633 X:49172437-49172459 CAGCCCGCCCTCCTGTGCCCAGG - Intronic
1190661205 X:52655767-52655789 CAGTCCTCCCACCTTGGCCTCGG + Intronic
1200093691 X:153647535-153647557 CCCCTGGCCCACCTGGCCCTGGG + Intronic
1200138702 X:153886770-153886792 CCTGCCGCCCACCTGGGCTCTGG - Intronic
1200182432 X:154158942-154158964 CATCCCGCCCACCGGGGCTTTGG + Exonic
1200188086 X:154196056-154196078 CATCCCGCCCACCGGGGCTTTGG + Intergenic
1200193736 X:154233196-154233218 CATCCCGCCCACCGGGGCTTTGG + Exonic
1200199491 X:154271000-154271022 CATCCCGCCCACCGGGGCTTTGG + Exonic