ID: 1035132229

View in Genome Browser
Species Human (GRCh38)
Location 7:156666166-156666188
Sequence TGAGATCCTAAAACATATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035132229_1035132234 6 Left 1035132229 7:156666166-156666188 CCCTCATATGTTTTAGGATCTCA 0: 1
1: 0
2: 1
3: 17
4: 228
Right 1035132234 7:156666195-156666217 GGGATACGTTTTTAATACTCAGG 0: 1
1: 0
2: 0
3: 1
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035132229 Original CRISPR TGAGATCCTAAAACATATGA GGG (reversed) Intronic
902600345 1:17536615-17536637 TGACATCACAAAACATATGCTGG - Intergenic
903655278 1:24945309-24945331 TGAGATCCTAATACATACCCAGG - Intronic
905158453 1:36009616-36009638 TGAGAATTTAAAACATATTAGGG + Intronic
905809118 1:40899098-40899120 TGGGATCCTAGGACATATGAGGG + Intergenic
907065090 1:51473496-51473518 TAAGTTCCTAAAACATATTAGGG + Intronic
907540008 1:55206835-55206857 TCAGATCCTAGAAAATATGAAGG - Intronic
907734306 1:57096910-57096932 TGGGCTCCTATAACATAGGAGGG + Intronic
908075740 1:60515817-60515839 TGTGAACCTAAAAGATAAGACGG - Intergenic
908927011 1:69267759-69267781 TGACAGCTTAACACATATGAAGG - Intergenic
911924292 1:103808524-103808546 TGAGTTCTCAAAACATCTGATGG + Intergenic
916028983 1:160860253-160860275 TGATAACCTGAATCATATGAGGG + Intronic
924706013 1:246502772-246502794 TGACATCCTAAAAGATGAGATGG - Intronic
1063158970 10:3405869-3405891 TGAGACACAAAAACAAATGATGG + Intergenic
1063159026 10:3406402-3406424 TGAGATCCTATAACAAAATAGGG - Intergenic
1064992024 10:21264516-21264538 TGAGTTCTTACAAGATATGAGGG + Intergenic
1067022715 10:42815747-42815769 AGAGCTCCAAAAACAAATGAAGG + Intronic
1071927747 10:90430296-90430318 TGAGTTCTTACAAGATATGATGG + Intergenic
1073594160 10:104784018-104784040 TCAGATCCTGAAACAGATCAAGG - Intronic
1073939819 10:108683636-108683658 TGAGATGCTTAAAAATATGAGGG - Intergenic
1076175834 10:128367154-128367176 TGAGATGATAAAAGATATTAAGG + Intergenic
1079365910 11:19809621-19809643 TGGGATCCTGAAACAGATAAAGG - Intronic
1081028840 11:38051716-38051738 TGAGTTCCTACAAGATCTGATGG - Intergenic
1083109590 11:60392174-60392196 TGAAAGCCTAAAAGGTATGATGG + Intronic
1086671139 11:89549394-89549416 TGTGATACTAACACATTTGAAGG - Intergenic
1087081267 11:94173243-94173265 TGAGACCCTATAACATTTAAGGG - Intronic
1087161059 11:94948539-94948561 AGAGCTCATAAAACATGTGAAGG - Intergenic
1087518852 11:99203510-99203532 TGAGATCTTTAAACATACAAAGG - Intronic
1088409782 11:109521459-109521481 TGAGATACTAAAATCAATGAAGG + Intergenic
1088756410 11:112888929-112888951 AGAGATCCCAACATATATGAAGG - Intergenic
1089011896 11:115138260-115138282 TCAGATTTTAAAACATGTGAGGG + Intergenic
1089904098 11:122020242-122020264 TGATATTTTAAAACCTATGATGG + Intergenic
1090227061 11:125078013-125078035 GGAGCTCCTAGAACACATGATGG - Intronic
1093757895 12:22872977-22872999 TGAACTCCTAAAAGGTATGAGGG + Intergenic
1094266069 12:28561553-28561575 TGTGATACTAAAAAATGTGATGG - Intronic
1095118915 12:38390272-38390294 TGAGCTTTTAAAATATATGATGG - Intergenic
1095172876 12:39056044-39056066 TGAGATCACACAACAGATGAGGG + Intergenic
1096486051 12:51982051-51982073 TGAGGTCCTCAAACATAGGGAGG - Intronic
1096964037 12:55610665-55610687 TGAGATTCTAAAACATAACTGGG - Intergenic
1097488161 12:60232292-60232314 TGAAATCCTTATACATATAAAGG + Intergenic
1097751029 12:63353196-63353218 TTAGTTCTTAAAATATATGATGG + Intergenic
1098001878 12:65953175-65953197 GGAGTTCATAAAAAATATGATGG - Intronic
1098519779 12:71421833-71421855 TGAGATGCCAAAACCCATGATGG + Intronic
1098597176 12:72287421-72287443 TGAGAAAGTAAAACATAGGATGG + Intronic
1100127012 12:91439503-91439525 AGAGATCCCAAAACATCTCAAGG + Intergenic
1100255797 12:92881480-92881502 TGAGATACTACAACATCTGGAGG + Intronic
1102708770 12:114906770-114906792 TGAGATCCTAGAACAGAAAAAGG - Intergenic
1102966028 12:117126317-117126339 TGACATCCTAAAACATGTTAAGG - Intergenic
1104680777 12:130749999-130750021 TGTGAACCTAGAACATTTGACGG - Intergenic
1108777123 13:53780365-53780387 TGAGACTCCAAAACATAGGAGGG + Intergenic
1109153826 13:58878999-58879021 TGAGTTACTAAAACATACAAAGG - Intergenic
1110196373 13:72793121-72793143 TGAGATCCTAAAAGACATTTAGG - Intronic
1110749806 13:79099817-79099839 TGACATCTGAAAACATATGAAGG + Intergenic
1111207929 13:85036189-85036211 TGAGTTCCTACAAGATATGATGG + Intergenic
1111864849 13:93755665-93755687 AGAGATTCTAAAACCTGTGAAGG + Intronic
1112111395 13:96303657-96303679 TGAGATCTGAAAAAATATCAAGG + Intronic
1112796679 13:103064794-103064816 TGAAAGACTAAACCATATGAAGG + Intronic
1113088928 13:106597143-106597165 TGGGATCCTAAAACAGATAAAGG - Intergenic
1115038292 14:28887824-28887846 TCATATCATGAAACATATGATGG - Intergenic
1116714034 14:48406163-48406185 TGAGTTCTCAAAAGATATGATGG - Intergenic
1117911881 14:60644351-60644373 TGAGCTCCCAAACCAAATGATGG + Exonic
1120031190 14:79643030-79643052 TCAGAAGCTAAATCATATGATGG - Intronic
1120263689 14:82221301-82221323 TGTGAACATAAAACATAAGAAGG + Intergenic
1120339183 14:83197161-83197183 TGAGATTCTAAAAATAATGATGG - Intergenic
1121218545 14:92267179-92267201 TGAGATCCTAGAACAGAACAAGG - Intergenic
1121723940 14:96132416-96132438 TGAGACCCTATAGCATTTGAGGG + Intergenic
1123423827 15:20152645-20152667 AGAGCTCCAAAAACAAATGAAGG + Intergenic
1123533049 15:21159166-21159188 AGAGCTCCAAAAACAAATGAAGG + Intergenic
1129030961 15:72617306-72617328 TGACATTCTAAAATATGTGAGGG - Intergenic
1129836856 15:78713946-78713968 TGACATTCTAAAATATGTGAAGG - Intronic
1133536956 16:6711512-6711534 TGAGTTCTCACAACATATGATGG + Intronic
1136861001 16:33702958-33702980 AGAGCTCCAAAAACAAATGAAGG - Intergenic
1137560203 16:49497480-49497502 TGAGTCCCTATAGCATATGAAGG + Intronic
1138061616 16:53897266-53897288 TGAGATTTTTATACATATGAAGG - Intronic
1138777162 16:59736957-59736979 TGAGATCTAAAAACAGAAGATGG - Intronic
1139068350 16:63347674-63347696 TTAGTTCCTATAACATATTATGG + Intergenic
1140635111 16:76903132-76903154 AGCCATCCTACAACATATGAGGG + Intergenic
1140667157 16:77238269-77238291 TGAGATATTAACACATAAGAAGG + Intergenic
1141581949 16:85005359-85005381 TGACAACATAAAACATTTGAAGG + Intronic
1144386734 17:14755140-14755162 TGATCTCATAAAACATATAATGG + Intergenic
1145354183 17:22123094-22123116 TCAGATTGGAAAACATATGAAGG - Intergenic
1147177148 17:38663137-38663159 AGAGATCCAAAAAAAGATGATGG + Intergenic
1149680184 17:58501079-58501101 TGAAATCCTGAAACCTATCACGG + Intronic
1151650688 17:75467392-75467414 TAAGATACTAAAACAAATAAAGG - Intronic
1153571319 18:6476033-6476055 TGAGATCCTGCAACATGGGATGG - Intergenic
1153664470 18:7356495-7356517 TGAGAGGTTAAGACATATGAAGG + Intergenic
1157029395 18:43887059-43887081 TGGGAACCTGAGACATATGAAGG - Intergenic
1158768361 18:60484248-60484270 TGAGATCCTAAAGAAAATAATGG - Intergenic
1159714144 18:71800072-71800094 TCAGAGCCTAAAACTTTTGAAGG - Intergenic
1160095562 18:75869221-75869243 TGAGATCTTAATAGACATGATGG - Intergenic
1160617091 18:80138534-80138556 TTAGATCCTAAAAAATATGAAGG + Exonic
1160745120 19:707865-707887 TAAGATCCTAAAGAATATCAGGG - Intergenic
1162293180 19:9793837-9793859 TGAGATCCTAACACTTTGGAAGG + Intergenic
1162868963 19:13571324-13571346 TCTGCTCCTAAAACATATCAGGG + Intronic
1163172019 19:15537910-15537932 TGATATGCTCAAACATATCAAGG - Exonic
1165450346 19:35878785-35878807 TGAGATCCTAGAAAATGAGAGGG + Intronic
925125208 2:1449725-1449747 TGAAATCGCAGAACATATGATGG + Intronic
925925763 2:8669027-8669049 TGAGTTCCTAGACCATATTAGGG - Intergenic
926023755 2:9520642-9520664 TTAGATCCTCAAAGATATTAAGG + Intronic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927345527 2:22034230-22034252 AGAGAACCTATAACATTTGAAGG + Intergenic
928430273 2:31212590-31212612 TGAGATCCTAAGAAATAGAAAGG + Intronic
928773047 2:34724837-34724859 TGAGTTCTCACAACATATGATGG + Intergenic
928879176 2:36077924-36077946 TGAGTTGCTAAAATAGATGAGGG + Intergenic
929617172 2:43320719-43320741 TGAAATCCTTGACCATATGATGG + Intronic
930670244 2:54142361-54142383 TGGGATCCTAAGACATAAAATGG - Intronic
933017702 2:77150512-77150534 TGAGATCTTAAAATGAATGAGGG - Intronic
934459370 2:94204121-94204143 AGAGCTCCAAAAACAAATGAAGG - Intergenic
939236070 2:139495195-139495217 TGAGATTCTAAAACTGAAGAAGG + Intergenic
939295182 2:140254095-140254117 TGAGACCCTAAGAAATAGGAAGG - Intronic
939370490 2:141292836-141292858 TGAGATCCTGGAACAGATAAAGG + Intronic
940040785 2:149358297-149358319 TGGGAACCTAAAACATACTAGGG + Intronic
940665375 2:156602133-156602155 TGTGATGCTAAAAGATTTGAGGG + Intronic
941839115 2:170060121-170060143 TAAAATCCTAAAATATAGGAAGG - Intronic
945040115 2:205736856-205736878 TTTGATCAGAAAACATATGAAGG + Intronic
947071474 2:226292333-226292355 TGAGATTCTAATACATTTGACGG + Intergenic
948085034 2:235240387-235240409 TGAGATCCTAACGCATCAGATGG - Intergenic
1169881403 20:10351119-10351141 TCAGATGAAAAAACATATGATGG + Intergenic
1169993538 20:11530416-11530438 TGTGACCCAAAAACATATAAAGG + Intergenic
1170271681 20:14534156-14534178 TGAAAGCCTAAAACACAGGAAGG + Intronic
1170404959 20:16026219-16026241 TTTGATCCTGAAACATCTGAAGG + Intronic
1175454091 20:59096743-59096765 TGTTATCCTAAGTCATATGAAGG + Intergenic
1179135385 21:38676013-38676035 TGAGATCCTAAAATATGTTGAGG - Intergenic
949697876 3:6720290-6720312 TGAGATCCTAGAACAGAAAAAGG + Intergenic
951349131 3:21583837-21583859 TGAGATCCTGATTCAAATGAAGG - Intronic
952598502 3:35048768-35048790 TGAGTTCCTAATCCATGTGAAGG - Intergenic
954056725 3:48032188-48032210 TGAGATCCTAGAACAGAAAAAGG + Intronic
955756407 3:62229170-62229192 TGAGATGCTAAAAGAGATGGGGG + Intronic
956567008 3:70650274-70650296 TGTGATTCTAAAAGATATGTCGG - Intergenic
956567150 3:70651875-70651897 TGTGATTCTAAAAGATATGTCGG + Intergenic
957974322 3:87423978-87424000 TGTGATTCTAAAACATAAGGTGG + Intergenic
958698457 3:97556526-97556548 TGAGTTCTTAAAAGATCTGATGG - Intronic
961995197 3:131234929-131234951 TGTGATCCTAAACCCTATAATGG - Intronic
964405728 3:156347467-156347489 TGAGAACCTAAATCATTGGAAGG + Intronic
964960230 3:162413428-162413450 ACATATCTTAAAACATATGAAGG - Intergenic
965384378 3:168028288-168028310 TGACATCAGAAAACATGTGATGG - Intronic
965422680 3:168481438-168481460 ACAGGTCCTAAAAAATATGATGG + Intergenic
968154611 3:196369612-196369634 TGAGATCTTAATACATAGGCCGG - Intronic
971344529 4:25799545-25799567 TGAGCTCCTACAACAGCTGATGG - Intronic
971496390 4:27270375-27270397 TGTGATCTTAAAATATTTGAGGG - Intergenic
971962337 4:33505485-33505507 TGCTATCCTAAAACATATTTTGG + Intergenic
972094563 4:35333378-35333400 TGAGTTCCCACAAGATATGATGG - Intergenic
975095517 4:70452416-70452438 TGAAATCTAAAAACATATAATGG - Intronic
975211838 4:71710142-71710164 TCAGATCCCAAAACCTAAGAGGG - Intergenic
976523263 4:86055188-86055210 AGAAATACTAAAACATATTATGG + Intronic
976681178 4:87757858-87757880 TGAGATATTAAAACAGATGCTGG - Intergenic
977347469 4:95835410-95835432 TGAGACACTAAACCATATGAGGG + Intergenic
978342567 4:107734054-107734076 CCAGATCCCAAAACATATGTTGG - Intergenic
978531455 4:109718753-109718775 TTAGATCCTATAAAATATAATGG + Exonic
978770018 4:112446141-112446163 TGAGATAATAAAACATATGTTGG - Intergenic
979365370 4:119815771-119815793 TGAGAACCAAAAAAATATGTTGG - Intergenic
979879642 4:125939374-125939396 TTAGATCTTAAAACCTTTGAAGG - Intergenic
982599422 4:157427551-157427573 TGAGATCCTGAAACAGAAAAAGG - Intergenic
982637024 4:157909681-157909703 TGAGATTCTAAATTATTTGAAGG - Intergenic
982884123 4:160756637-160756659 TATGTTCCTAAAACACATGATGG - Intergenic
982938755 4:161521159-161521181 TGTTCTCCTAAAACATTTGATGG + Intronic
983133653 4:164053437-164053459 TGTGATGCTAACACACATGAAGG + Intronic
983344330 4:166507220-166507242 TGAGTTCTTAAAAGATCTGATGG - Intergenic
984176432 4:176424122-176424144 GAACATCTTAAAACATATGATGG + Intergenic
984348823 4:178565865-178565887 TGAGTTCCTAGGACCTATGATGG + Intergenic
986951685 5:13094840-13094862 TGAAATCCCAAAATATATGGAGG + Intergenic
988645070 5:33085887-33085909 TGAGCTCTTAAAAGATCTGATGG - Intergenic
988912086 5:35853475-35853497 TGAGATCCTAAAATGTTAGAGGG - Intronic
989230695 5:39083238-39083260 TGAGTTCTCAAAAGATATGATGG - Intergenic
989555707 5:42792149-42792171 TGAGATCCTGAAAAATAGAATGG - Intronic
989721047 5:44528399-44528421 TGAGCTCCTCCAGCATATGAGGG + Intergenic
990341819 5:54830878-54830900 TTAGATCCTAAAGCACAGGAAGG - Intergenic
991058842 5:62350001-62350023 TCAGATCATGATACATATGAGGG + Intronic
991574793 5:68091626-68091648 TGAGCTCCTAAAAAATAAAACGG + Intergenic
992353872 5:75958987-75959009 TGAGGTCTTAAAATATTTGAGGG - Intergenic
992845977 5:80748086-80748108 TGAGATCGTAGAACAAATAATGG + Intronic
993497519 5:88624025-88624047 TGGGATCCTAGAACAGATAAAGG + Intergenic
996447791 5:123576613-123576635 TGTGCTCCTAAAAAATATTAAGG - Intronic
997748499 5:136321026-136321048 TGAGATCCTAGAACATTTCCTGG + Intronic
998577237 5:143329253-143329275 GGAGATCGCAAAACATCTGATGG - Intronic
998666146 5:144299747-144299769 AAAAATCCTAAAACATATTAAGG - Intronic
998808567 5:145942478-145942500 TGAGGTCAGAAAACATATCAGGG + Intronic
999115806 5:149162412-149162434 TGAGATACTGAAACACATGAAGG - Intronic
999496294 5:152101665-152101687 TAAGATGCTCAATCATATGAGGG + Intergenic
1000025249 5:157353276-157353298 AGAGATGCTAAAACTTTTGAAGG - Intronic
1000302631 5:159970086-159970108 TGAGATCCCAAAACATTTTATGG - Intronic
1003033342 6:2621647-2621669 TTCTATCTTAAAACATATGAAGG - Intergenic
1003354844 6:5358452-5358474 TGAGATGCTTAAAAACATGAAGG + Intronic
1008917209 6:56801203-56801225 TGAGATCCTAAAACAAAAAGAGG - Intronic
1009822587 6:68823354-68823376 TCAGTTCCCAAAACATATGATGG - Intronic
1010149608 6:72715422-72715444 TGAGAGCCTAAAGCATAACAAGG - Intronic
1010650892 6:78454752-78454774 TGAGTTCTTACAATATATGATGG - Intergenic
1012578605 6:100834500-100834522 TTAAATCCCAAAACATATGTGGG + Intronic
1013890997 6:115027072-115027094 TGAGTTCTTACAACATCTGATGG + Intergenic
1014183084 6:118406832-118406854 TCAGATCATAAAACAGATGTTGG + Intergenic
1015876038 6:137823684-137823706 TGACATCCCAAAATAAATGAAGG - Intergenic
1015937177 6:138415755-138415777 TGGGATCCCAAAACATGGGATGG + Exonic
1020466540 7:8486038-8486060 TGGGATTTTAAAACATATGATGG + Intronic
1020473930 7:8572463-8572485 TGAGGTGCTAAAACGTATGCAGG - Intronic
1020754063 7:12179066-12179088 TGAGATAGTAAAAAAAATGAGGG + Intergenic
1024722916 7:52158047-52158069 TGAGATAGGAAAACATATAAAGG - Intergenic
1027546058 7:79528956-79528978 TGAGATGCTAAAGGAAATGATGG - Intergenic
1027758953 7:82252960-82252982 AGAGAGGCTAAAACATACGAAGG + Intronic
1028422390 7:90648384-90648406 TGAGGTCTTAAAACACATAAGGG - Intronic
1029834421 7:103294566-103294588 AGAGATGCTAATAAATATGAAGG + Intergenic
1029847347 7:103426296-103426318 TTAGATCTCAAAACATAAGATGG + Intronic
1030938776 7:115618673-115618695 TGAAATCCTGAAACAGGTGATGG - Intergenic
1031042044 7:116848923-116848945 TGAGTTCCAAAACCATATGGGGG - Intronic
1033280134 7:140000523-140000545 CTAGATCCTAAACTATATGATGG + Intronic
1034532581 7:151705884-151705906 TGAAATCATAAAACATGTGTAGG - Intronic
1034938603 7:155215618-155215640 TGTTATCCTCAAACATCTGAGGG + Intergenic
1035132229 7:156666166-156666188 TGAGATCCTAAAACATATGAGGG - Intronic
1036012708 8:4745800-4745822 TGAGATGCTAGTACAAATGAGGG + Intronic
1039288134 8:36064999-36065021 TTACATCTTAAAAAATATGAAGG - Intergenic
1040631262 8:49214748-49214770 TGATATCCTAAAACTTGTCAGGG - Intergenic
1041532075 8:58880312-58880334 TGAGTTCCTAAAATGTAAGATGG + Intronic
1041644136 8:60234342-60234364 TGAGATCCCAGAACAGAAGAAGG + Intronic
1042460275 8:69057769-69057791 TGGAATCCTAAAATATAAGAGGG - Intergenic
1042512307 8:69624796-69624818 TGAGTTCATTAAACTTATGAGGG - Intronic
1042632990 8:70841637-70841659 TGTGACCCTAAAACATGTCAAGG - Intergenic
1043381481 8:79706844-79706866 ACAGAACTTAAAACATATGAGGG - Intergenic
1043576296 8:81662099-81662121 TGTGCTTCAAAAACATATGATGG - Intronic
1046161440 8:110371541-110371563 TAAAATTCTAAAATATATGAAGG + Intergenic
1046402864 8:113729858-113729880 TGATTTGCTAAAATATATGAAGG + Intergenic
1046950699 8:120016973-120016995 TCATATTCTAAAAAATATGATGG - Intronic
1047651668 8:126929451-126929473 TGACTTCCTAGAACATATAAGGG + Intergenic
1048129004 8:131671810-131671832 TGAGATACTGACAGATATGATGG - Intergenic
1049021803 8:139962171-139962193 TGAGGTACAAAGACATATGAAGG - Intronic
1052130338 9:24838198-24838220 TGAGATATTAAAAAATATAATGG - Intergenic
1053218158 9:36289834-36289856 TGAGGTCCAAAACCATATGCTGG - Intronic
1053689869 9:40579905-40579927 AGAGCTCCAAAAACAAATGAAGG - Intergenic
1054301116 9:63380849-63380871 AGAGCTCCAAAAACAAATGAAGG - Intergenic
1054712657 9:68526742-68526764 TGAGATACTACAAAATATTAGGG - Intronic
1055754316 9:79541464-79541486 TGAAATTCTAAGAAATATGATGG + Intergenic
1055917154 9:81416122-81416144 TGAGATTCTCACACAGATGATGG + Intergenic
1057116593 9:92528806-92528828 TTGGATCCTAAAACATTTGTTGG - Intronic
1059125577 9:111681556-111681578 TGAGATCCTATAACATAAATAGG + Intergenic
1059198075 9:112389762-112389784 TGAGATTCTAAAATATATGTGGG + Intronic
1060270855 9:122140083-122140105 TGAGATTCTAATACTTTTGAAGG + Intergenic
1061662374 9:132138792-132138814 TTAGATCCTCAATAATATGATGG + Intergenic
1186380764 X:9056282-9056304 AGAGCTCCTAAAATAAATGAAGG + Intronic
1187128591 X:16478791-16478813 TGAGATCATACAACATATAATGG - Intergenic
1188414782 X:29919244-29919266 TGAAATGCTAAAATAAATGAAGG + Intronic
1188558858 X:31444780-31444802 TGAAATCCTAAAAAATAAAAAGG + Intronic
1189633160 X:42976199-42976221 AGAGATCCTAAAGCAACTGAAGG - Intergenic
1189839320 X:45056371-45056393 AGAAATCCTAACAAATATGAGGG - Intronic
1191658078 X:63621245-63621267 TGGGATCCTAAAACAGAAAAAGG - Intergenic
1192544265 X:72000160-72000182 TGAGATCATAATTCATATGTAGG - Intergenic
1193838307 X:86374510-86374532 TGAGATTTTACAACATATGGTGG - Intronic
1196123697 X:112077728-112077750 TCAGATCCTAAAATAAATTAGGG + Intronic
1196921080 X:120585789-120585811 TGAGATCCTAGAACAGAAAAAGG - Intergenic
1198492828 X:137159920-137159942 TGGGATCCTAAAACAAAAAAAGG + Intergenic
1201330959 Y:12820405-12820427 TGATATGCTAATACATATAAGGG - Intronic