ID: 1035133244

View in Genome Browser
Species Human (GRCh38)
Location 7:156675267-156675289
Sequence ACAGCACACAGGCCTTGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 162}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035133244_1035133256 25 Left 1035133244 7:156675267-156675289 CCACGGCAAGGCCTGTGTGCTGT 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1035133256 7:156675315-156675337 GAGACGAGGGTGCCTCTCACAGG No data
1035133244_1035133251 11 Left 1035133244 7:156675267-156675289 CCACGGCAAGGCCTGTGTGCTGT 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1035133251 7:156675301-156675323 TCCCTCCGTCTTTGGAGACGAGG 0: 1
1: 0
2: 0
3: 7
4: 106
1035133244_1035133248 3 Left 1035133244 7:156675267-156675289 CCACGGCAAGGCCTGTGTGCTGT 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1035133248 7:156675293-156675315 CTCCCGGCTCCCTCCGTCTTTGG No data
1035133244_1035133258 29 Left 1035133244 7:156675267-156675289 CCACGGCAAGGCCTGTGTGCTGT 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1035133258 7:156675319-156675341 CGAGGGTGCCTCTCACAGGAGGG No data
1035133244_1035133253 12 Left 1035133244 7:156675267-156675289 CCACGGCAAGGCCTGTGTGCTGT 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1035133253 7:156675302-156675324 CCCTCCGTCTTTGGAGACGAGGG No data
1035133244_1035133257 28 Left 1035133244 7:156675267-156675289 CCACGGCAAGGCCTGTGTGCTGT 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1035133257 7:156675318-156675340 ACGAGGGTGCCTCTCACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035133244 Original CRISPR ACAGCACACAGGCCTTGCCG TGG (reversed) Intronic
900088130 1:908429-908451 ACTGCACACAGGCCTCTCCCAGG - Intergenic
900375212 1:2351113-2351135 ACAGCCAACAGGCCTCACCGTGG - Intronic
900471472 1:2857064-2857086 GCAGCACACAGACCTCCCCGGGG - Intergenic
900617954 1:3573738-3573760 GCAGCTCCCAGGCCTGGCCGTGG + Intronic
900640487 1:3685935-3685957 ACACCACACAGGCCCGGCCTCGG + Intronic
901385095 1:8902917-8902939 TGAACAGACAGGCCTTGCCGGGG + Intergenic
902646678 1:17804481-17804503 ACAGCACCCAGGTCTTGCTTTGG - Intronic
905648540 1:39640805-39640827 CCAGCAAGCAGGCCTTGCTGTGG - Intergenic
905766938 1:40609146-40609168 ACAAAACAGAGGCCTTGCCCAGG - Intergenic
905891161 1:41519219-41519241 GCAGGACAGAGGCCTTGCCCAGG - Intronic
905953700 1:41974587-41974609 ACAGCACACAGGACATCCCAGGG - Intronic
907015241 1:51005856-51005878 ACAGCACTCAAGCTTTGCCAAGG + Intergenic
910466441 1:87505321-87505343 TCAGCACACAGGCCTCCCAGAGG + Intergenic
920586847 1:207172847-207172869 ACAGGACACAGCCAATGCCGGGG + Intergenic
922799945 1:228360562-228360584 ACTGCCCACAGGCCGAGCCGGGG - Intronic
1063005182 10:1963681-1963703 AAAACACACAGGCCAGGCCGGGG - Intergenic
1063594796 10:7424514-7424536 GAAGCAAACAGGCCGTGCCGAGG - Intergenic
1063610942 10:7561544-7561566 ACAGCAGACAGGCCCTGGTGTGG + Exonic
1064672489 10:17731025-17731047 ACAGCATACTGGCCTAGACGAGG - Intergenic
1067784096 10:49229891-49229913 CCAGCCCACAGGCCTTGGCTAGG - Intergenic
1073993368 10:109289068-109289090 CCAGCAAACAAGCCTTGCCCTGG + Intergenic
1075125146 10:119693476-119693498 TGAGCACACAGGCCATGCCTTGG - Intergenic
1076067255 10:127458646-127458668 CAGGCACACAGGCCTTGCCTGGG + Intergenic
1076712086 10:132342549-132342571 ACAGCACGCAGGGCCTGCAGAGG - Intronic
1077115492 11:882843-882865 ACAGCATACAGGCCGGGCCGGGG - Intronic
1077510941 11:2962321-2962343 ACATCACACAGGCTTGGCTGGGG - Intronic
1088080281 11:105903509-105903531 ACAACAGAAAGGCCTTGCCTAGG + Intronic
1089000123 11:115044895-115044917 ACAGGACACAGGCCCTGTTGTGG - Intergenic
1089962817 11:122630769-122630791 ACTGCAGACAGGCCTGGCGGAGG - Intergenic
1090400438 11:126445266-126445288 ACAGCCCACAGGCATTGTCTGGG - Intronic
1093065648 12:14655488-14655510 GCAGCACACAGGACTTGGGGAGG + Intronic
1096517635 12:52165875-52165897 GCAGCACACAGGGCCTGCCTTGG + Intergenic
1098193840 12:67978464-67978486 CCAGCACCCAGGCATTGCTGTGG - Intergenic
1098440986 12:70518101-70518123 ACAGCACACAGACATTTTCGGGG - Exonic
1101741592 12:107504025-107504047 GGAGCACACAGCCCTTGCTGGGG - Intronic
1101755930 12:107620640-107620662 ACAGAACACAGACCCTGCTGAGG + Intronic
1104625504 12:130350860-130350882 GCAGCACACAGACCTTTCCAAGG - Intronic
1107453912 13:40536974-40536996 ACAGCAAACAGGCCCAGCAGGGG + Intergenic
1112547587 13:100386669-100386691 GCAGCACACAGGGCTGGGCGCGG - Intronic
1112626993 13:101116261-101116283 ACAGCACAAAGGCAATGCAGGGG - Intronic
1113443877 13:110350814-110350836 ACAGCACACTTGCCATGGCGGGG + Intronic
1113633032 13:111900796-111900818 GCTGCACAGAGGCCTTGCTGCGG - Intergenic
1113759129 13:112835466-112835488 ACAGCACCCTGGGCTTCCCGGGG + Intronic
1117893094 14:60448116-60448138 TCAGGACACAGGCATGGCCGAGG + Intronic
1118780449 14:69004388-69004410 ATAGCACACAGGGCTGGCCTGGG - Intergenic
1119147270 14:72328701-72328723 ACAGCTCTCAGGCCTTCCAGAGG - Intronic
1121124744 14:91398972-91398994 CCAGCACACAGGGCTGCCCGAGG - Intronic
1121969585 14:98344061-98344083 AAAGGACACAGGCCCTGCAGGGG + Intergenic
1122315684 14:100824948-100824970 ACAGCAGAGAGGCCCCGCCGAGG - Intergenic
1122362432 14:101175338-101175360 ACAGAACCCAGCCCTTGCCCAGG + Intergenic
1122881423 14:104692130-104692152 CCAGCACACAGACCCTGCCCAGG - Intronic
1123018313 14:105385981-105386003 CCAGCACACGGGCCTGGCCAGGG - Intronic
1124138641 15:27057572-27057594 ACAGCCCAGAGGCCTTTCCAGGG - Intronic
1130040912 15:80404578-80404600 GCAGCCCGCAGGCCTTGCCCGGG + Intronic
1130317404 15:82808685-82808707 ACACCTCACAGGCCTTGCTTTGG + Intergenic
1132568374 16:633472-633494 GCAGCACGCAGGCGTCGCCGGGG - Exonic
1132728251 16:1348120-1348142 ACAACACACAGGCCGCGCGGCGG - Exonic
1133502310 16:6377942-6377964 ACAGGACACAGGACATGCCTGGG - Intronic
1135992194 16:27224833-27224855 ACAGCTCACTGTCCTTGCCCAGG - Intergenic
1136517059 16:30774603-30774625 ACAGGACAGAAGCCCTGCCGAGG - Exonic
1138187217 16:54986064-54986086 ACAGCAGGCAGGACTGGCCGTGG + Intergenic
1139849618 16:69942812-69942834 GCAGCACACAGACCTGCCCGAGG - Intergenic
1140953399 16:79840098-79840120 GGAGCACACAGGACTTGCTGAGG + Intergenic
1141979150 16:87539027-87539049 TGAGCACACAGGCCCCGCCGGGG - Intergenic
1142218021 16:88839342-88839364 GCAGCACAAAGGCCTTGCTCAGG + Intronic
1142226434 16:88879967-88879989 ACAGCACAGAGCCCTGGACGAGG - Intronic
1143790650 17:9292684-9292706 ACAGCTCACAGTCCTGGCCCTGG + Intronic
1146952904 17:36919015-36919037 ACAGAACACATGACTTGCAGTGG - Intergenic
1148243803 17:46017191-46017213 ACAGCCCACAGGACTTTCCAGGG - Intronic
1149416156 17:56462006-56462028 ACAGCACTCAGGCCTTGATGGGG - Intronic
1150135282 17:62692019-62692041 AAAGCACACAGGCCTGGGCCGGG - Intronic
1151184287 17:72351934-72351956 ACAGCCCGCAGGCCTGGCCTGGG - Intergenic
1151524623 17:74656052-74656074 ACAGCACACATGCCCTTCAGTGG + Intergenic
1152140246 17:78532268-78532290 ACACCACACAGGCCTGCACGGGG - Intronic
1152576069 17:81141570-81141592 ACACCACAGAGGCTTTGCTGGGG - Intronic
1203161913 17_GL000205v2_random:60336-60358 ACAGGACTCAGGTTTTGCCGAGG + Intergenic
1153907971 18:9679520-9679542 ACAGGACTCGGGCTTTGCCGAGG + Intergenic
1155242668 18:23878550-23878572 TCAGCACTCAGGACTTGCCACGG - Intronic
1157148118 18:45187057-45187079 AAAGCACCCAGGCTTTGCTGCGG - Intergenic
1157567646 18:48690527-48690549 ACAGCACACTGGACTAGCTGTGG + Intronic
1158325764 18:56312647-56312669 ACAGGACACAGGCCTTCCTTTGG + Intergenic
1160564466 18:79778489-79778511 ACAGCTGACAGGCCGTGCAGGGG + Intergenic
1161053937 19:2180512-2180534 AGGGAACACAGACCTTGCCGGGG - Intronic
1161219084 19:3109729-3109751 ACAGCACACAGACGTGGCGGCGG - Intronic
1162910686 19:13846655-13846677 ACATCAAACAGGCCCTGCCGAGG + Intergenic
1163650757 19:18516325-18516347 ACAGCACACCGGCCATGCCTGGG + Intronic
1165743288 19:38216267-38216289 ACAGCAGACAGGCATTGGCACGG + Intronic
1167108364 19:47444470-47444492 ACAGCTCACAGCCCACGCCGAGG - Intronic
1167666776 19:50826938-50826960 ACACCACACAGGCCTCCCCCGGG + Exonic
1167882594 19:52473124-52473146 ACAAGACACAGGCTTTGTCGAGG - Intronic
925196545 2:1930541-1930563 ATGGCACACACGCCTTGCCCAGG + Intronic
932084780 2:68748210-68748232 ACAGCAGACAGGCCTTGAGATGG - Intronic
935656902 2:105430844-105430866 AGAGCAGACAGGCCTTGCTGGGG + Intronic
937874340 2:126809909-126809931 ACAGCACACAGGGCGGGCCCAGG - Intergenic
939853278 2:147325691-147325713 ACAACACAAAGGCCTGGACGAGG + Intergenic
942338027 2:174912072-174912094 ACAGCACCCAGGGCTTGCCAGGG + Intronic
948671950 2:239574532-239574554 ACAGCAGACAGGACCTGCCCTGG - Intergenic
948877434 2:240837135-240837157 ACAGCACAGCGGCCCTGCAGAGG - Intergenic
948927435 2:241108389-241108411 CCAGCACACAGGCCAGGCAGTGG + Intronic
1170976839 20:21172923-21172945 ACAGTACAGAGGCCATGCAGTGG + Intronic
1172760049 20:37315281-37315303 ACAGCCCACAGGCCTCGTCCAGG - Intronic
1176679404 21:9811396-9811418 CCAGGACACAGGCGCTGCCGGGG - Intergenic
1178981630 21:37269461-37269483 ACAGAAGCCAGGCCTTGCAGAGG - Intergenic
1180060215 21:45381219-45381241 GCCACACACAGGCCTTGCCTGGG - Intergenic
1180929490 22:19579231-19579253 ACAGAACACAGGCCATCCCCAGG - Intergenic
1181235802 22:21446996-21447018 CCAGCCCACAGGCCCTGCGGTGG - Exonic
1182501999 22:30754667-30754689 ACAGCACACAGGCTTCCCTGAGG - Intronic
1182932667 22:34189992-34190014 ACAGCACCCAGACCTTGCAATGG + Intergenic
1184556916 22:45238424-45238446 ACAGCACACAGACCATGACAAGG + Intronic
949354374 3:3162626-3162648 ACTGCACACAGCATTTGCCGTGG - Intronic
952242131 3:31542343-31542365 ACAGCAAACAGTCCATGCCCAGG - Intronic
953127961 3:40109947-40109969 ACAGGACACAGTCCCTGCCTAGG + Intronic
955401062 3:58591913-58591935 ACAGCACAGAGGCCTTTATGTGG - Intronic
958009601 3:87859664-87859686 AGAGCACACAGGCTCTGCCTAGG - Intergenic
959340079 3:105118070-105118092 ACAGCACACAGGCCCTCACAAGG - Intergenic
961368299 3:126415009-126415031 ACAGCCCACAGGCCCAGCCCTGG - Intronic
966931426 3:184678187-184678209 ACTGGGCACAGGCCTTGCCGGGG - Intronic
967206611 3:187128772-187128794 ATTACACACAGACCTTGCCGTGG - Intronic
968616085 4:1578538-1578560 GCATCACACGGGCCTTGCTGGGG + Intergenic
968946499 4:3667248-3667270 ACAGCACACAGGGCTTCTTGAGG - Intergenic
969369059 4:6719770-6719792 ACACCACACAGACATTCCCGTGG + Intergenic
970387063 4:15566518-15566540 TCAGCACACAGGCCTGGGCATGG + Intronic
976269501 4:83217100-83217122 ACTGCACCCAGGCCTTGGAGTGG - Intergenic
980404924 4:132344172-132344194 ACAGCACACCCGCCCTGCCAAGG - Intergenic
986792990 5:11181440-11181462 AGAGCACACAGGCTGTGCCCCGG + Intronic
992888228 5:81180566-81180588 ACAGCACAGAGGCCTTGTTGTGG - Intronic
994087114 5:95771442-95771464 ACTGCACACAGGGCTGGCCGTGG - Intronic
994571349 5:101517930-101517952 AGAGCACACAGGGCCTGCCCAGG - Intergenic
994770354 5:103973732-103973754 ACAGCACTCAGGTCTTGGCAAGG - Intergenic
995073059 5:107947324-107947346 ACATGGCACAGGCCTTGCCTGGG + Intronic
997472586 5:134125043-134125065 CCAGCACACAGGCCTCTCCATGG - Intronic
1002102420 5:176864001-176864023 ACAGCACACATACCCTGTCGAGG + Intronic
1002423810 5:179164310-179164332 AATGCACACAGACCTTGCCCTGG - Intronic
1002442672 5:179272547-179272569 ACTGGACTCAGGCCTGGCCGGGG + Intronic
1004666507 6:17752844-17752866 CCAGCACACAGCCCCTGCCATGG - Intergenic
1005419217 6:25631666-25631688 ACAGAACACAGCCCATGCTGAGG - Intergenic
1006465187 6:34189730-34189752 ACAGGACTCAGGTTTTGCCGAGG - Intergenic
1006788019 6:36680637-36680659 ATAGCACACAGGCTTTCCCGCGG + Intronic
1018280829 6:162183700-162183722 AAATCAGACAGGCCTTGCCTTGG - Intronic
1019171820 6:170137076-170137098 AGAGATCACAGCCCTTGCCGAGG + Intergenic
1019174658 6:170154016-170154038 AGAGCACACAGGCCTGGGCTGGG - Intergenic
1028766799 7:94569101-94569123 ACAGCACAGATGCATTGCTGTGG + Intergenic
1034788613 7:153947728-153947750 TGAGCACACAGACCTTGCTGCGG - Intronic
1035133244 7:156675267-156675289 ACAGCACACAGGCCTTGCCGTGG - Intronic
1037984954 8:23284704-23284726 CCAGCACACTCTCCTTGCCGTGG - Intronic
1038762986 8:30401923-30401945 GCAGCACCCAGGCTTTGCCTGGG - Intronic
1038894957 8:31772317-31772339 ACAGAAGACAGGTCTTTCCGTGG - Intronic
1039697000 8:39923582-39923604 ACTGCACACAACACTTGCCGTGG - Exonic
1039809802 8:41036548-41036570 ATAGCACACAGTCATTGCTGTGG - Intergenic
1040434695 8:47379198-47379220 ACAGCCCACAGGCATTCCTGTGG - Intronic
1040441077 8:47443214-47443236 ACAGCCCACAGGCATTCCTGTGG - Intronic
1041023508 8:53660915-53660937 ACAGTAAACAGGCCCTGGCGAGG - Intergenic
1041136101 8:54760991-54761013 ACAGCACACAGGCATCTCTGGGG + Intergenic
1042271777 8:66962499-66962521 GGAGCACACACGCCTGGCCGCGG - Exonic
1042566072 8:70113493-70113515 AGAGCAGACAGGCCTGGCCCTGG - Exonic
1044392149 8:91663695-91663717 ACAGCACCCAGACCCTGCCCTGG + Intergenic
1045479925 8:102583586-102583608 ACAGAACAGAGGCCTTGGCAAGG - Intergenic
1048583949 8:135755607-135755629 GCAGCACAAAAGCCTTGCTGAGG + Intergenic
1049700946 8:144012290-144012312 CCTGTACACAGGCCTTGCCTCGG - Intronic
1051619252 9:19034799-19034821 ACATCACACAGTCCTTACAGAGG + Intronic
1052607332 9:30722234-30722256 ACACCACACAGCCCTTTCAGGGG - Intergenic
1053607372 9:39674589-39674611 ACAGCTGACAGGCCTTGCCTAGG + Intergenic
1053865223 9:42430946-42430968 ACAGCTGACAGGCCTTGCCTAGG + Intergenic
1054246162 9:62667820-62667842 ACAGCTGACAGGCCTTGCCTAGG - Intergenic
1054560285 9:66702353-66702375 ACAGCTGACAGGCCTTGCCTAGG - Intergenic
1055465502 9:76561529-76561551 ACAGCCCACAGGCCTCTCTGTGG + Intergenic
1057021113 9:91698216-91698238 TGAACACACAGGCCTTGCCTGGG + Intronic
1059506690 9:114805808-114805830 ACTGCACACAGGCCTCTCCCTGG + Exonic
1059772714 9:117442951-117442973 GCAGCACATAGCCCCTGCCGTGG - Intergenic
1062437789 9:136554301-136554323 CCAGCCCACAGGCCTGGCCCAGG - Intergenic
1062578032 9:137217624-137217646 AGAGCAGGCAGGCCTTGCTGGGG + Intergenic
1203664573 Un_KI270754v1:13932-13954 CCAGGACACAGGCGCTGCCGGGG - Intergenic
1186202509 X:7168664-7168686 CCTGCACCCAGGCCTTGCAGTGG + Intergenic
1186975818 X:14903442-14903464 ACAGAACACAGGCCTTGTCTAGG + Intronic
1189015568 X:37093162-37093184 GCAGCACCCAGGCTTTGCCTGGG - Intergenic
1189560428 X:42186392-42186414 GCAGCACACATGCCTGGCCCAGG + Intergenic
1197831348 X:130646400-130646422 TCAGCACTCAGGCCAGGCCGTGG + Intronic
1199692261 X:150317553-150317575 AAAACACAGAGGCCTTGCCTAGG + Intergenic