ID: 1035133246

View in Genome Browser
Species Human (GRCh38)
Location 7:156675278-156675300
Sequence GCCGGGAGGAGACAGCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 224}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035133246_1035133248 -8 Left 1035133246 7:156675278-156675300 CCTGTGTGCTGTCTCCTCCCGGC 0: 1
1: 0
2: 0
3: 12
4: 224
Right 1035133248 7:156675293-156675315 CTCCCGGCTCCCTCCGTCTTTGG No data
1035133246_1035133251 0 Left 1035133246 7:156675278-156675300 CCTGTGTGCTGTCTCCTCCCGGC 0: 1
1: 0
2: 0
3: 12
4: 224
Right 1035133251 7:156675301-156675323 TCCCTCCGTCTTTGGAGACGAGG 0: 1
1: 0
2: 0
3: 7
4: 106
1035133246_1035133258 18 Left 1035133246 7:156675278-156675300 CCTGTGTGCTGTCTCCTCCCGGC 0: 1
1: 0
2: 0
3: 12
4: 224
Right 1035133258 7:156675319-156675341 CGAGGGTGCCTCTCACAGGAGGG No data
1035133246_1035133253 1 Left 1035133246 7:156675278-156675300 CCTGTGTGCTGTCTCCTCCCGGC 0: 1
1: 0
2: 0
3: 12
4: 224
Right 1035133253 7:156675302-156675324 CCCTCCGTCTTTGGAGACGAGGG No data
1035133246_1035133257 17 Left 1035133246 7:156675278-156675300 CCTGTGTGCTGTCTCCTCCCGGC 0: 1
1: 0
2: 0
3: 12
4: 224
Right 1035133257 7:156675318-156675340 ACGAGGGTGCCTCTCACAGGAGG No data
1035133246_1035133256 14 Left 1035133246 7:156675278-156675300 CCTGTGTGCTGTCTCCTCCCGGC 0: 1
1: 0
2: 0
3: 12
4: 224
Right 1035133256 7:156675315-156675337 GAGACGAGGGTGCCTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035133246 Original CRISPR GCCGGGAGGAGACAGCACAC AGG (reversed) Intronic
900150077 1:1174451-1174473 ACCGGCAGGAGACGGCACCCCGG - Exonic
900783455 1:4632643-4632665 GCCCACAGGACACAGCACACAGG + Intergenic
900783527 1:4633277-4633299 GCCCACAGGACACAGCACACAGG + Intergenic
902398837 1:16146508-16146530 GCCGGGACGAGGCAGCCCAGTGG - Intronic
903929063 1:26851806-26851828 GCCTGGGGGAGACAGGGCACAGG + Intronic
904453750 1:30633997-30634019 GCTTGGAGGACACAGCACAGAGG - Intergenic
905150303 1:35921841-35921863 TCTGGGAGGAGGCAGCTCACTGG + Exonic
905203183 1:36327699-36327721 CCCTGGAGAAGACAGCACTCTGG - Exonic
905253453 1:36664918-36664940 TTTGGGAGGAGACAGCAGACTGG - Intergenic
906639499 1:47433180-47433202 GAGGGGAGGACACAGGACACAGG + Intergenic
906804526 1:48767491-48767513 GTGAGGAGGAGACAGAACACAGG + Intronic
907927204 1:58966020-58966042 GCTGGGAGGAGAGAGAACCCAGG + Intergenic
911444427 1:97972318-97972340 GCTGGGAGGAGAGACCACATTGG - Intergenic
912704093 1:111899159-111899181 GCAGGGAGGAGACAGAACAGAGG - Intronic
912821561 1:112871803-112871825 GCTGGAAGGAGACAGCTCACAGG + Intergenic
916412938 1:164564408-164564430 GGCGGGGGGAGAGGGCACACAGG + Intronic
919273862 1:195386063-195386085 GCTGGCAGGAGAGAGCATACAGG - Intergenic
921167168 1:212515322-212515344 GCAGTGCGGAGACAGCCCACAGG - Intergenic
922825291 1:228513399-228513421 GCCGGGAGGAGACGGGTCTCAGG + Intergenic
923019911 1:230155256-230155278 GCGGGCAGGAGCCAGCACAAGGG - Intronic
923462765 1:234221372-234221394 GCCTAGAGGAGGCAGCATACCGG + Intronic
924642251 1:245845447-245845469 GCCAGAAGGAGATAGCACACAGG + Intronic
1063200697 10:3783556-3783578 GCCGGTGGGAGCAAGCACACGGG + Intronic
1064134617 10:12740049-12740071 GACGGGATGAAACAGCACACAGG - Intronic
1066610998 10:37248460-37248482 GCAGGAAGGAGTCAACACACTGG - Intronic
1067222709 10:44355610-44355632 GCAGGGAGGTGGCAGCACAGAGG + Intergenic
1069913440 10:71773302-71773324 GCTGGGAGAAGACAGCAGACTGG - Intronic
1070829348 10:79409144-79409166 TCCATGAGTAGACAGCACACAGG + Intronic
1072591848 10:96833488-96833510 GCGGAGCGGAGACACCACACGGG - Intronic
1073845002 10:107544852-107544874 GCTGGGTGGTGACAGCACCCGGG - Intergenic
1076355654 10:129850897-129850919 GACGGGAGGAGAAAGCACCGGGG + Intronic
1076532390 10:131153712-131153734 GCTGGGAGCAGCCAGCACCCTGG + Intronic
1077240723 11:1509072-1509094 GCAGGGAGGAGACACAGCACAGG + Intergenic
1077795881 11:5491517-5491539 GCAGGAAGGAGACAGCAAAGAGG + Intronic
1077829983 11:5857003-5857025 GCAGGCAGAAGACAGCATACAGG + Exonic
1078508576 11:11969077-11969099 GCCATGAGGAGACAGCACCTGGG - Intronic
1079169775 11:18081763-18081785 GCCGGGAGGAGTCAGCAGGAGGG - Intronic
1079871232 11:25800831-25800853 GCGGGAAGGAGAAAGAACACAGG - Intergenic
1081814351 11:45930158-45930180 GCTGGGAGGTGACAGCCCAAGGG + Intronic
1083159762 11:60847853-60847875 GCCGAGAGGAGACAGGGCATGGG + Intronic
1083573549 11:63772890-63772912 GCTGGCTGGAGACACCACACAGG - Intergenic
1085087426 11:73679672-73679694 GCCGGGAATGGAAAGCACACAGG - Exonic
1085353268 11:75814674-75814696 GCCGGGAAAAGACTGCACAAGGG + Intergenic
1086936592 11:92751845-92751867 GCCGGAAAGTGACAGAACACGGG - Intronic
1088459752 11:110070200-110070222 GCCAGGAGGAGACAGATCAGAGG - Intergenic
1089128078 11:116191351-116191373 GCTGGGAGGAGACAGGGCTCAGG + Intergenic
1089401476 11:118166842-118166864 GAGGGGAGGAGACGGGACACGGG + Exonic
1089624493 11:119742551-119742573 GGGGAGAGGAGACCGCACACTGG - Intergenic
1089659630 11:119977620-119977642 GGCGGGAGGAGCCAACACAGAGG + Intergenic
1090879943 11:130824609-130824631 GTCGGGAGGAGACAACTCGCAGG + Intergenic
1091760450 12:3084031-3084053 GCTGGGAGGAGACAGGAAGCAGG - Intronic
1093233399 12:16576329-16576351 CCAGGGAGTAGACAGCACATTGG - Intronic
1095985411 12:47995973-47995995 GCTGGGAGAAGATGGCACACTGG - Intronic
1097762343 12:63482225-63482247 GCAGGGAGGAGAGAGCAGCCTGG + Intergenic
1098377434 12:69832223-69832245 GCCAGGGGGAGAAAGCACTCAGG - Intronic
1100437103 12:94581773-94581795 GGCTGGTGGAGCCAGCACACTGG - Exonic
1102523522 12:113494315-113494337 GGAGGGAGGAGACAGCAGGCAGG + Intergenic
1102717312 12:114985635-114985657 AGAGGGAGGAGACAGCTCACAGG - Intergenic
1103795295 12:123499191-123499213 GGCGGGAGGAGCCTGCTCACCGG + Intronic
1104267537 12:127249317-127249339 GCAGGAGCGAGACAGCACACAGG - Intergenic
1104395391 12:128428011-128428033 CCCCGGAGGAGCCAGCACTCTGG - Intronic
1105014356 12:132777133-132777155 AGCGGGAGGGCACAGCACACTGG - Intronic
1115307125 14:31944745-31944767 GCAGGGAAGAAACAGCACAGAGG - Intergenic
1115410526 14:33068918-33068940 TCAGGGAGGCAACAGCACACGGG + Intronic
1118366493 14:65101814-65101836 GCAGGGAGGAGACAGTGCTCGGG - Intronic
1119266976 14:73268536-73268558 TCCTGGAGGAGAGAGGACACTGG - Exonic
1119475022 14:74922294-74922316 GCAGGGAGGAGACAACAGGCAGG - Exonic
1119797200 14:77409381-77409403 GGTGGCAGGAGAGAGCACACAGG - Intronic
1120724908 14:87927624-87927646 GCAGGAAGGAAAAAGCACACTGG - Intronic
1121405440 14:93716790-93716812 GCCGGGAGCCATCAGCACACAGG - Intergenic
1123487679 15:20755893-20755915 CCCGGGAGGAGACAGGGGACGGG + Intergenic
1123544171 15:21324951-21324973 CCCGGGAGGAGACAGGGGACGGG + Intergenic
1127661202 15:61101833-61101855 ACCGGGTGGGGACAGCAGACAGG + Intronic
1128423608 15:67518605-67518627 GCCAGGGGGAGAAAGCACTCAGG - Intergenic
1128674607 15:69599481-69599503 GAAGGAAGGAGCCAGCACACTGG + Intergenic
1128782787 15:70374061-70374083 TCCGGGAGGAGACAGGAGAGAGG - Intergenic
1130166976 15:81471568-81471590 GCCATGAGCAGACAGCAAACTGG - Intergenic
1130661404 15:85833921-85833943 GCTGGGAGGAGAATGCCCACAGG - Intergenic
1131447133 15:92509807-92509829 GTTGGGAGGAAACAGCACAGAGG - Intergenic
1202952514 15_KI270727v1_random:52222-52244 CCCGGGAGGAGACAGGGGACGGG + Intergenic
1132482360 16:172911-172933 GTCGGCAGGAGACAGCACCATGG - Exonic
1132483208 16:176715-176737 GTCGGCAGGAGACAGCACCATGG - Exonic
1132557824 16:580158-580180 GTAGGGAGGGGCCAGCACACCGG - Intronic
1132879184 16:2153872-2153894 GCCGGGAGCAGGCAGCTCCCAGG - Exonic
1134781891 16:16905793-16905815 GCCTTGAGGAGACAGCAGAGAGG + Intergenic
1135085702 16:19472999-19473021 TCCAGGAGGAGGCAGCACTCTGG - Intronic
1136004379 16:27318702-27318724 GCCGAGAGGTTACAGCACCCAGG - Intronic
1136115396 16:28091310-28091332 GGCGGAAGGAGACAGCATCCCGG - Intergenic
1138186731 16:54983006-54983028 GCAGGGAGCACACAGCCCACTGG + Intergenic
1138533171 16:57646090-57646112 CCCGGCAGGAGACAGCAGAGAGG + Intronic
1139419485 16:66841580-66841602 ACAGGGAGGAGACTGGACACCGG - Intronic
1141255346 16:82397083-82397105 GCCAGCAGCAGGCAGCACACAGG - Intergenic
1141712866 16:85710098-85710120 GCCCGGTGGAGACAGCTCTCAGG - Intronic
1141727741 16:85800510-85800532 GGGGGGAGGTGACAGCTCACAGG - Intronic
1142034802 16:87856348-87856370 GCCTGCTGGAGACAGCACAGAGG + Intronic
1142221134 16:88855838-88855860 GCTGGTCGGAGCCAGCACACAGG + Intronic
1142809801 17:2390261-2390283 GCAGGGAAGAGACAGGACAGAGG - Intronic
1143289865 17:5820481-5820503 GGCGGGAGGAGACTGCATAGCGG - Intronic
1143625828 17:8109732-8109754 GCCGGTAGGAGACCGGAGACCGG + Intronic
1144316803 17:14069551-14069573 CCCGTGAGGAGAGAGGACACAGG + Exonic
1145192158 17:20852227-20852249 GCCTGGCGGAGACAGCGCAGGGG + Intronic
1145402382 17:22552271-22552293 GCCTGGCGGAGACAGCGCAGGGG + Intergenic
1145995499 17:29102761-29102783 GCCGAGAGGACCAAGCACACAGG + Intronic
1148177934 17:45584270-45584292 GCCCGGTGGAGACACTACACTGG + Intergenic
1149461728 17:56834351-56834373 CCCGGGAGGAGACGGCGCCCCGG + Intronic
1149544964 17:57496620-57496642 TCCGGGAGGACAGAGCACGCAGG + Intronic
1149650102 17:58271339-58271361 GCTGGGAGGGGACTGCCCACTGG + Intronic
1150822125 17:68443825-68443847 GGGGTGAGGAGTCAGCACACTGG - Intronic
1151421202 17:73999080-73999102 GCCGGGTGGAGAGAGTACAGAGG + Intergenic
1151884261 17:76914333-76914355 GCCGGGAGGAGAAAGAGCGCAGG + Intronic
1152714934 17:81894635-81894657 GCAGGCAGCAGACAGCACAGAGG - Intronic
1153312316 18:3689057-3689079 GCCTGGAGGAGACAGAGCACAGG - Intronic
1153544351 18:6190953-6190975 GGCTGGAGTAGACAGCACATGGG + Intronic
1154169311 18:12038950-12038972 GCTGCGAGGCGACAGCACAACGG + Intergenic
1154385256 18:13887132-13887154 GCAGGTGGGACACAGCACACAGG - Intronic
1154385272 18:13887184-13887206 GCAGGTGGGACACAGCACACAGG - Intronic
1154385288 18:13887236-13887258 GCAGGTGGGACACAGCACACAGG - Intronic
1154385304 18:13887286-13887308 GCAGGTGGGACACAGCACACAGG - Intronic
1154385317 18:13887338-13887360 GCAGGTGGGACACAGCACACAGG - Intronic
1154385332 18:13887390-13887412 GCAGGTGGGACACAGCACACAGG - Intronic
1158931666 18:62329308-62329330 GCTGTGAGGAGACAGCAGTCAGG - Intronic
1160298522 18:77658526-77658548 GCAGGCAGGGGTCAGCACACAGG + Intergenic
1161233977 19:3188986-3189008 GCCCGGGGGTGAAAGCACACCGG - Intronic
1162569938 19:11465863-11465885 GCAGGGAGGGGACTGCTCACAGG + Intronic
1163845794 19:19637564-19637586 GCCGGGTGGAGACAGCAGGTTGG + Intronic
1164213117 19:23117360-23117382 GCAGGGAAGAGACAGGACGCCGG - Intronic
1164477570 19:28587039-28587061 GCCCAGAGGAGACAGCATCCAGG + Intergenic
1166097231 19:40548461-40548483 GCCTGGATGACACAGCACCCAGG + Intronic
1166432911 19:42741730-42741752 GCAGGGAGCAGGCAGGACACAGG + Intronic
1166892310 19:46000950-46000972 CCCGGGAGGAGACCGCACAGAGG - Intronic
1167695031 19:51010138-51010160 GGGAGGAGGAGACAGAACACGGG + Intergenic
1167887738 19:52516010-52516032 GCCAGGAGGAGGCTGGACACTGG - Intergenic
1168356676 19:55704453-55704475 GCCGGGAGAAGACAGCCGTCTGG + Intronic
1168420945 19:56202979-56203001 TCTGGGAGTATACAGCACACAGG - Intronic
1168702692 19:58451244-58451266 GCAGGGAGGAGAAAACGCACCGG - Intergenic
925055116 2:851271-851293 GCCTGGAGGAGGATGCACACTGG + Intergenic
925844635 2:8024386-8024408 GCAGGAAGGACACAGCACCCAGG + Intergenic
925893705 2:8456043-8456065 GCTGGGAGGGGACAGCAGGCAGG + Intergenic
927690868 2:25207256-25207278 GCAGGGAGGAGACGTCACAAGGG + Intergenic
933858593 2:86441946-86441968 GCCGGGCGGAGACAGCAGGGAGG - Intronic
935448338 2:103180325-103180347 GCCGGGAGGAGGGTGCACATTGG + Intergenic
938272016 2:129980637-129980659 GCCGGGAATGGAAAGCACACAGG + Exonic
938296539 2:130182583-130182605 GCCGGGCGGAGAGGGCTCACCGG + Exonic
938443991 2:131363177-131363199 GCCGGGAATGGAAAGCACACAGG - Intergenic
938460209 2:131492046-131492068 GCCGGGCGGAGAGGGCTCACCGG - Intronic
942515214 2:176745521-176745543 GCCAGGAGGAGGCAGCAAAATGG + Intergenic
945949248 2:216023222-216023244 GCCAGGAGGTGGCAGCACAGAGG - Intronic
947863729 2:233381150-233381172 GCCAGCAGGAGAGAGCGCACCGG - Intronic
1170402369 20:16002280-16002302 GCCTGGAGTAGACAGAACAATGG + Intronic
1171052006 20:21868214-21868236 GCCTGAAGAAGACAGCAGACTGG + Intergenic
1172615384 20:36280033-36280055 CACAGGAAGAGACAGCACACAGG - Intergenic
1175029170 20:55935070-55935092 GATGGGAGGAGACAGCACTTTGG - Intergenic
1176217244 20:63954042-63954064 GCAGGGAGGAGCTAGCCCACAGG + Intronic
1178262979 21:31116864-31116886 CCAGAGAGGAGACAGAACACCGG + Intergenic
1180063723 21:45402613-45402635 GCAGGGAGGAGAGAGCATCCAGG - Intergenic
1183937930 22:41274507-41274529 GCCTGGAAGAGACTGGACACAGG + Intronic
949929870 3:9070286-9070308 GCAGGGTGGAGGAAGCACACAGG - Intronic
950866841 3:16196405-16196427 GCCCAGAGAAGACAGCAGACTGG + Intronic
951624480 3:24644918-24644940 GGCGGGAGGAGTCACCACAGGGG - Intergenic
952142834 3:30498801-30498823 GTTGGCAGGAGACAGCACAGTGG + Intergenic
955067666 3:55546783-55546805 GTGGGGAGGAGACAGCTCTCTGG - Intronic
958498468 3:94875122-94875144 GCTGGGTTGAGACAGCACTCTGG + Intergenic
958641623 3:96813857-96813879 GCCGGGAGGAAGCAGCAGAGGGG - Intergenic
959002568 3:100981759-100981781 GCAGAGAGGAGCCAGGACACTGG - Intronic
961747372 3:129073122-129073144 GGCTGGAGGAGAGGGCACACGGG + Intergenic
962647103 3:137451133-137451155 GTAGGGAGGAGCCAGCTCACAGG + Intergenic
963804999 3:149714168-149714190 GCCGGGAGCAGGCAGCAGCCTGG + Intronic
963904628 3:150763250-150763272 GCCGGGCGGAGCCAGCGCCCCGG - Exonic
967880332 3:194297195-194297217 GCCGGGAGGAGCCAGCAAGCTGG - Intergenic
968480652 4:831669-831691 GCTGGGAGGAGACAGTGGACAGG + Intergenic
970916078 4:21336913-21336935 ACTGGGAGAACACAGCACACAGG + Intronic
978113188 4:104987178-104987200 GCCGGGTGGAGAAAACACAGAGG + Intergenic
984821737 4:183888506-183888528 GTCGGGAGGAAACAGGACATGGG - Intronic
985877129 5:2608683-2608705 GCCGGGAGAGGTCAGCCCACGGG + Intergenic
986284531 5:6349540-6349562 GCCGGGAGGGGCCAGCAAACCGG + Intergenic
987315213 5:16717767-16717789 ACTGAGAGGTGACAGCACACTGG + Intronic
987365815 5:17147694-17147716 GCCTGGCGGTGACAGCATACAGG - Intronic
989770244 5:45135993-45136015 GTCGGGGGGAGACAGCTTACAGG + Intergenic
1002549241 5:179974759-179974781 GGCGAGTGGAGACAGAACACTGG + Intronic
1003503156 6:6718863-6718885 GCTGGGATGAGACAGGACAGTGG - Intergenic
1006339845 6:33440791-33440813 GCCGGGAGGACATCGCAGACAGG + Exonic
1007214723 6:40228196-40228218 GCCAGGTTGAGACAGCACCCAGG - Intergenic
1007313912 6:40969045-40969067 GGGGGGAGTAGTCAGCACACTGG + Intergenic
1012889864 6:104885703-104885725 GCCGGGTCGTGACAGCACCCGGG - Intergenic
1013353052 6:109323172-109323194 GTAGGAAGGAGACAGCACACTGG - Intergenic
1015457000 6:133437733-133437755 GCAGGGAGGAGAATGAACACAGG + Intronic
1017528880 6:155267707-155267729 GCCAGGAGGAAAAAGCACTCAGG - Intronic
1017848692 6:158283527-158283549 TCAGGCAGGAAACAGCACACAGG - Intronic
1018640331 6:165898791-165898813 GCAGGGAGGAGGCAGCAGCCAGG - Intronic
1019508057 7:1403406-1403428 GCCTCCAGGAGACACCACACTGG + Intergenic
1019695610 7:2444494-2444516 GCCAGGAGGGGACAGCCCAGAGG - Intergenic
1019746198 7:2701624-2701646 GCCTGGCAGAGACAGCACACGGG + Intronic
1020009892 7:4802034-4802056 GCCAGGTGGACACAGCACTCGGG + Intronic
1022819831 7:33948654-33948676 GCCAGCAGGAGACAGAACAAAGG - Intronic
1023770240 7:43550465-43550487 GTCTGGAGGAGCCAACACACAGG + Exonic
1024048098 7:45599071-45599093 GCAGGGGGCTGACAGCACACAGG - Intronic
1028210211 7:88064612-88064634 CCCTGGAGGACACAGCACAAAGG - Intronic
1029144885 7:98438850-98438872 GCTGGGAGGGGACACCACCCCGG - Intergenic
1030069054 7:105683095-105683117 GCCAGCAGGATACAGCAAACAGG + Intronic
1034532629 7:151706233-151706255 GGCAGGAGGAGACAGCAGTCAGG - Intronic
1035022046 7:155805835-155805857 GCGGGGAGGAGCCAGGACGCGGG + Intronic
1035133246 7:156675278-156675300 GCCGGGAGGAGACAGCACACAGG - Intronic
1035750882 8:1995424-1995446 GCCAGGAGGAAACACCACTCAGG - Intronic
1036791010 8:11720050-11720072 GCAGGGAGGTGAAAGCACATTGG + Intronic
1037432702 8:18830482-18830504 CCCAGGAGGACACAGAACACAGG + Intronic
1037846009 8:22282927-22282949 TCCTGGAGGAGACAGCAAAAGGG - Intronic
1039949076 8:42153507-42153529 GCCTGGAGGAGACAGCAGGAGGG - Intronic
1040871179 8:52101193-52101215 GCCTGGAGCACACAGCGCACAGG - Intergenic
1042334918 8:67620010-67620032 GCCTGGAGGAGGCAGCCCAGCGG - Intronic
1043150234 8:76705894-76705916 GCCTGGAGGAGACGGCTCACCGG + Exonic
1045267281 8:100630485-100630507 TCAGGGAGGAGACAGAGCACTGG - Intronic
1045844549 8:106618029-106618051 GGCGGGAGGAGAAGGCACTCTGG + Intronic
1049606023 8:143529597-143529619 GTCGGGGGGAGACCCCACACAGG + Intronic
1051629571 9:19128925-19128947 GCAGGGAGGATACAGCAGAGAGG + Intronic
1052184924 9:25581515-25581537 GCCTGCAGTAGACAGCACAAAGG + Intergenic
1052609944 9:30759088-30759110 GCCAGGTTGAGACAGCACTCAGG + Intergenic
1054808146 9:69412534-69412556 GCAGGGAGGAGACATCAGGCTGG - Intergenic
1056309081 9:85321463-85321485 GAAGGGAGGAGCCAGCACAAAGG + Intergenic
1057881228 9:98794377-98794399 GCTGGAAGGTGTCAGCACACAGG + Intronic
1058662905 9:107282991-107283013 GCCGGGCGGAGCCTGCACAGAGG + Intergenic
1059336678 9:113573442-113573464 GCCGTGAGGAAGCGGCACACTGG + Intronic
1061173829 9:128979590-128979612 GTGGGCTGGAGACAGCACACTGG - Intronic
1061464103 9:130764132-130764154 GCCTGGAGGAGACAGCAAGGCGG + Intronic
1062101929 9:134732998-134733020 GCAGGGAGGAGCCAGCACCAAGG + Intronic
1062140432 9:134954724-134954746 GCCTGGAGGGGTCAGCACAGAGG - Intergenic
1186221982 X:7359008-7359030 GCCGTGAGGAGACATGTCACAGG + Intergenic
1188769151 X:34131296-34131318 TCCGGGCGGAGACTGGACACCGG + Exonic
1188769215 X:34131602-34131624 TCCGGGCGGAGACTGGACACCGG + Exonic
1188965203 X:36543091-36543113 GCAGGGAGAAGACACCACTCAGG - Intergenic
1189007218 X:37009026-37009048 TCCGGGCGGAGACTGGACACCGG - Exonic
1189335534 X:40168671-40168693 GCCTGGAGGAGACGCCACATCGG + Intronic
1190596843 X:52060081-52060103 GCAGGGAGGTGAGAGCACCCTGG - Intergenic
1190611981 X:52193992-52194014 GCAGGGAGGTGAGAGCACCCTGG + Intergenic
1192146708 X:68687514-68687536 GCAGGGAGGAAATAGCAAACTGG + Intronic
1196043080 X:111226904-111226926 GCCAGGAGGAGCCAGATCACAGG + Intronic
1197342133 X:125287297-125287319 GCTGGGTGGTGACAGCACCCAGG - Intergenic
1199200999 X:145088676-145088698 GCAGGAAGGAGAATGCACACAGG - Intergenic